Incidental Mutation 'R2985:Jakmip2'
ID 257792
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.302) question?
Stock # R2985 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 43571181 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 366 (T366I)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect possibly damaging
Transcript: ENSMUST00000082254
AA Change: T366I

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: T366I

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Ccdc83 A G 7: 90,236,367 probably benign Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Cul1 T A 6: 47,502,507 F236I probably damaging Het
Etl4 T C 2: 20,781,849 V470A probably damaging Het
Fndc1 T C 17: 7,756,323 E1428G possibly damaging Het
Gal3st1 A G 11: 3,998,618 Y275C probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Obscn A G 11: 59,133,089 F585S probably damaging Het
Olfr923 G A 9: 38,828,110 V140I probably benign Het
Oxld1 T C 11: 120,457,036 T112A probably benign Het
Pcdha9 A G 18: 36,998,202 N108S possibly damaging Het
Pkd1l2 T C 8: 117,065,551 S501G probably benign Het
Pls1 G A 9: 95,785,582 T91M possibly damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Trpm5 G T 7: 143,082,938 L421I probably damaging Het
Ttn A T 2: 76,744,274 V25425E probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6612:Jakmip2 UTSW 18 43557367 missense probably damaging 1.00
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GCGGGCATTTGAAATGAAACC -3'
(R):5'- AACGTACTCGGCCATTTTAGTTC -3'

Sequencing Primer
(F):5'- ACCAGAAGTATGAAGTGCTTTGTG -3'
(R):5'- ACTCGGCCATTTTAGTTCATGTATG -3'
Posted On 2015-01-11