Incidental Mutation 'R1367:Mfsd13a'
ID156101
Institutional Source Beutler Lab
Gene Symbol Mfsd13a
Ensembl Gene ENSMUSG00000025227
Gene Namemajor facilitator superfamily domain containing 13a
Synonyms4930538D17Rik, Tmem180, 4930449A08Rik
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R1367 (G1)
Quality Score221
Status Validated
Chromosome19
Chromosomal Location46341121-46375252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46366504 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 40 (T40I)
Ref Sequence ENSEMBL: ENSMUSP00000119072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086969] [ENSMUST00000128041] [ENSMUST00000128455] [ENSMUST00000142994]
Predicted Effect probably benign
Transcript: ENSMUST00000086969
AA Change: T40I

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084189
Gene: ENSMUSG00000025227
AA Change: T40I

DomainStartEndE-ValueType
Pfam:MFS_2 15 441 6.2e-23 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128041
AA Change: T40I

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119072
Gene: ENSMUSG00000025227
AA Change: T40I

DomainStartEndE-ValueType
Pfam:MFS_2 9 441 1.1e-26 PFAM
low complexity region 453 463 N/A INTRINSIC
transmembrane domain 470 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137143
Predicted Effect probably benign
Transcript: ENSMUST00000142994
AA Change: T40I

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122944
Gene: ENSMUSG00000025227
AA Change: T40I

DomainStartEndE-ValueType
Pfam:MFS_2 8 318 7.8e-17 PFAM
Meta Mutation Damage Score 0.0965 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Mfsd13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Mfsd13a APN 19 46366519 missense probably damaging 1.00
IGL01380:Mfsd13a APN 19 46367908 missense probably damaging 1.00
IGL01773:Mfsd13a APN 19 46369294 missense possibly damaging 0.60
IGL02458:Mfsd13a APN 19 46372247 missense probably damaging 1.00
IGL02955:Mfsd13a APN 19 46367753 missense possibly damaging 0.81
R0057:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0113:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0114:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0115:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0361:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R0656:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1174:Mfsd13a UTSW 19 46374686 missense probably benign 0.13
R1210:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1251:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R1364:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1365:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1366:Mfsd13a UTSW 19 46366504 missense probably benign 0.22
R1692:Mfsd13a UTSW 19 46372076 missense probably benign 0.00
R1852:Mfsd13a UTSW 19 46372180 critical splice acceptor site probably null
R1968:Mfsd13a UTSW 19 46372053 missense probably damaging 1.00
R2846:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R2985:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3415:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3416:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3431:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3432:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R3735:Mfsd13a UTSW 19 46368328 missense probably damaging 1.00
R4393:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4394:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4396:Mfsd13a UTSW 19 46371992 missense probably damaging 1.00
R4920:Mfsd13a UTSW 19 46367216 missense probably damaging 1.00
R5289:Mfsd13a UTSW 19 46368280 missense probably benign 0.00
R5806:Mfsd13a UTSW 19 46366410 missense probably benign 0.01
R6153:Mfsd13a UTSW 19 46367882 missense probably damaging 1.00
R6514:Mfsd13a UTSW 19 46374625 unclassified probably null
R6558:Mfsd13a UTSW 19 46366478 missense probably damaging 1.00
R6649:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6649:Mfsd13a UTSW 19 46372265 missense probably benign
R6653:Mfsd13a UTSW 19 46367866 missense probably damaging 0.99
R6911:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
R7022:Mfsd13a UTSW 19 46368324 nonsense probably null
R7334:Mfsd13a UTSW 19 46368370 missense probably damaging 1.00
R7525:Mfsd13a UTSW 19 46369277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTAATAGGCAACCGCAGAGCTAC -3'
(R):5'- TGCTAAACAGCACAGTCTGCCC -3'

Sequencing Primer
(F):5'- ccgcagagctacagacc -3'
(R):5'- GCACAGTCTGCCCAAAAG -3'
Posted On2014-02-11