Incidental Mutation 'R3116:Fdft1'
ID264043
Institutional Source Beutler Lab
Gene Symbol Fdft1
Ensembl Gene ENSMUSG00000021273
Gene Namefarnesyl diphosphate farnesyl transferase 1
Synonymssqualene synthase, SQS, Ss
MMRRC Submission 040589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3116 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location63145150-63179578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63177698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 28 (I28M)
Ref Sequence ENSEMBL: ENSMUSP00000153238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038229] [ENSMUST00000054963] [ENSMUST00000223810] [ENSMUST00000224625] [ENSMUST00000225157] [ENSMUST00000225841] [ENSMUST00000226002]
Predicted Effect probably benign
Transcript: ENSMUST00000038229
SMART Domains Protein: ENSMUSP00000045200
Gene: ENSMUSG00000035121

DomainStartEndE-ValueType
Blast:Fapy_DNA_glyco 2 177 7e-94 BLAST
H2TH 188 272 1.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054963
AA Change: I28M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055313
Gene: ENSMUSG00000021273
AA Change: I28M

DomainStartEndE-ValueType
Pfam:SQS_PSY 47 320 2.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223810
AA Change: I28M

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000224625
AA Change: I28M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000225157
Predicted Effect probably benign
Transcript: ENSMUST00000225841
Predicted Effect probably benign
Transcript: ENSMUST00000226002
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die around E9.5-10.5. Conditional homozygous null in which the gene is deleted specifically in oligodendrocyte and Schwann cell display dysmyelination of spinal cord and brain white matter, and showed ataxia and tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,896,610 I37F possibly damaging Het
Ccdc146 T C 5: 21,316,955 N357S probably benign Het
Csmd3 A G 15: 47,657,599 F2783S probably damaging Het
Desi2 T A 1: 178,244,442 M104K probably damaging Het
Disp1 C T 1: 183,088,922 V645I probably benign Het
Dock8 A T 19: 25,188,494 H1914L probably benign Het
Ffar3 T C 7: 30,855,806 M30V probably benign Het
Grm3 A T 5: 9,570,752 F164Y probably damaging Het
Ints5 T C 19: 8,894,772 S32P possibly damaging Het
Itgam T A 7: 128,116,029 S908R probably damaging Het
Kif20b C T 19: 34,970,080 P1565L probably benign Het
Kntc1 A G 5: 123,802,058 E1610G probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
March6 G A 15: 31,486,119 S362F probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Ncor2 A T 5: 125,024,166 L2195Q probably damaging Het
Neil1 A T 9: 57,146,663 D124E probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nipbl T A 15: 8,343,592 M1057L probably benign Het
Npas3 G A 12: 54,067,725 probably null Het
Oas1h C T 5: 120,861,616 Q55* probably null Het
Olfr39 A T 9: 20,286,227 H176L probably benign Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Olfr701 T A 7: 106,818,364 F94I probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Pum1 T C 4: 130,772,660 V1051A probably damaging Het
Pxdn T C 12: 30,002,307 S828P possibly damaging Het
Rad21 T A 15: 51,965,001 E557V probably null Het
Rtn3 T G 19: 7,431,990 N888H probably damaging Het
Slc12a5 T A 2: 164,996,181 probably null Het
Slc7a11 T A 3: 50,384,139 M274L probably benign Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Tacc2 A G 7: 130,759,249 N825S probably damaging Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tln2 T A 9: 67,355,139 D610V probably benign Het
Tmed11 C T 5: 108,779,839 V110M probably damaging Het
Tmem92 T C 11: 94,782,428 D3G possibly damaging Het
Trp53rkb C T 2: 166,794,089 probably benign Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Zfp804a C A 2: 82,259,417 Q1197K probably damaging Het
Other mutations in Fdft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Fdft1 APN 14 63163389 nonsense probably null
PIT4515001:Fdft1 UTSW 14 63164583 missense probably benign 0.30
R0012:Fdft1 UTSW 14 63177698 missense probably benign 0.03
R0442:Fdft1 UTSW 14 63163349 missense probably benign 0.29
R0735:Fdft1 UTSW 14 63163420 missense probably damaging 1.00
R1674:Fdft1 UTSW 14 63164585 missense probably benign 0.20
R1689:Fdft1 UTSW 14 63156689 missense probably benign 0.00
R3418:Fdft1 UTSW 14 63156621 missense probably damaging 1.00
R5033:Fdft1 UTSW 14 63163404 missense probably damaging 1.00
R5274:Fdft1 UTSW 14 63152343 missense probably damaging 1.00
R5371:Fdft1 UTSW 14 63151301 missense probably damaging 1.00
R5747:Fdft1 UTSW 14 63146839 missense probably damaging 1.00
R6343:Fdft1 UTSW 14 63151272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTGAACAGACAGAAACCTTG -3'
(R):5'- ATCAACGTCCGTCAGTCCAC -3'

Sequencing Primer
(F):5'- GTGTCAGAGACCATCCAT -3'
(R):5'- GTCCGTCAGTCCACTCCGC -3'
Posted On2015-02-05