Incidental Mutation 'R3116:Zfp804a'
ID264006
Institutional Source Beutler Lab
Gene Symbol Zfp804a
Ensembl Gene ENSMUSG00000070866
Gene Namezinc finger protein 804A
Synonyms
MMRRC Submission 040589-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R3116 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location82053222-82259879 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 82259417 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1197 (Q1197K)
Ref Sequence ENSEMBL: ENSMUSP00000041941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047527]
Predicted Effect probably damaging
Transcript: ENSMUST00000047527
AA Change: Q1197K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041941
Gene: ENSMUSG00000070866
AA Change: Q1197K

DomainStartEndE-ValueType
ZnF_C2H2 57 81 7.29e0 SMART
low complexity region 588 595 N/A INTRINSIC
low complexity region 801 808 N/A INTRINSIC
low complexity region 1012 1029 N/A INTRINSIC
low complexity region 1061 1077 N/A INTRINSIC
low complexity region 1168 1191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127187
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger binding protein. Polymorphisms in this gene, especially rs1344706, are thought to confer increased susceptibility to schizophrenia, bipolar disorder, and heroin addiciton. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,896,610 I37F possibly damaging Het
Ccdc146 T C 5: 21,316,955 N357S probably benign Het
Csmd3 A G 15: 47,657,599 F2783S probably damaging Het
Desi2 T A 1: 178,244,442 M104K probably damaging Het
Disp1 C T 1: 183,088,922 V645I probably benign Het
Dock8 A T 19: 25,188,494 H1914L probably benign Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Ffar3 T C 7: 30,855,806 M30V probably benign Het
Grm3 A T 5: 9,570,752 F164Y probably damaging Het
Ints5 T C 19: 8,894,772 S32P possibly damaging Het
Itgam T A 7: 128,116,029 S908R probably damaging Het
Kif20b C T 19: 34,970,080 P1565L probably benign Het
Kntc1 A G 5: 123,802,058 E1610G probably damaging Het
Krt24 T A 11: 99,282,436 T298S possibly damaging Het
Magoh T C 4: 107,887,212 V126A possibly damaging Het
March6 G A 15: 31,486,119 S362F probably benign Het
Mier3 T A 13: 111,706,648 I178N probably damaging Het
Moxd1 G T 10: 24,301,531 E582* probably null Het
Ncor2 A T 5: 125,024,166 L2195Q probably damaging Het
Neil1 A T 9: 57,146,663 D124E probably benign Het
Nhsl1 A T 10: 18,525,168 Q714L probably damaging Het
Nipbl T A 15: 8,343,592 M1057L probably benign Het
Npas3 G A 12: 54,067,725 probably null Het
Oas1h C T 5: 120,861,616 Q55* probably null Het
Olfr39 A T 9: 20,286,227 H176L probably benign Het
Olfr448 T C 6: 42,896,850 V133A probably benign Het
Olfr485 T C 7: 108,159,822 E17G probably benign Het
Olfr651 C A 7: 104,553,088 H56Q probably benign Het
Olfr701 T A 7: 106,818,364 F94I probably damaging Het
Phactr2 C A 10: 13,261,901 E166* probably null Het
Prkdc C T 16: 15,664,358 L422F probably benign Het
Pum1 T C 4: 130,772,660 V1051A probably damaging Het
Pxdn T C 12: 30,002,307 S828P possibly damaging Het
Rad21 T A 15: 51,965,001 E557V probably null Het
Rtn3 T G 19: 7,431,990 N888H probably damaging Het
Slc12a5 T A 2: 164,996,181 probably null Het
Slc7a11 T A 3: 50,384,139 M274L probably benign Het
Svs1 A G 6: 48,987,397 Y113C probably damaging Het
Tacc2 A G 7: 130,759,249 N825S probably damaging Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tln2 T A 9: 67,355,139 D610V probably benign Het
Tmed11 C T 5: 108,779,839 V110M probably damaging Het
Tmem92 T C 11: 94,782,428 D3G possibly damaging Het
Trp53rkb C T 2: 166,794,089 probably benign Het
Wdr91 A G 6: 34,905,587 L209P probably damaging Het
Zfp511 T A 7: 140,036,591 D46E probably benign Het
Other mutations in Zfp804a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Zfp804a APN 2 82053875 missense probably benign 0.30
IGL02011:Zfp804a APN 2 82256691 missense probably damaging 1.00
IGL02218:Zfp804a APN 2 82259202 missense probably damaging 1.00
IGL02645:Zfp804a APN 2 82053876 missense possibly damaging 0.94
PIT4431001:Zfp804a UTSW 2 82259192 missense probably benign 0.04
R0027:Zfp804a UTSW 2 82257200 missense probably damaging 1.00
R0167:Zfp804a UTSW 2 82256516 missense probably damaging 1.00
R0437:Zfp804a UTSW 2 82053791 start codon destroyed probably null 0.08
R0521:Zfp804a UTSW 2 82259417 nonsense probably null
R0546:Zfp804a UTSW 2 82258920 missense possibly damaging 0.91
R0609:Zfp804a UTSW 2 82257588 missense probably damaging 1.00
R0694:Zfp804a UTSW 2 82053804 missense probably damaging 1.00
R0837:Zfp804a UTSW 2 82259162 missense probably damaging 1.00
R0947:Zfp804a UTSW 2 82258718 missense possibly damaging 0.58
R1103:Zfp804a UTSW 2 82257500 missense probably damaging 0.99
R1168:Zfp804a UTSW 2 82256697 missense probably benign 0.43
R1365:Zfp804a UTSW 2 82257246 missense probably benign 0.00
R1377:Zfp804a UTSW 2 82258497 missense probably benign 0.39
R1501:Zfp804a UTSW 2 82235799 missense probably damaging 1.00
R1526:Zfp804a UTSW 2 82258188 missense probably benign
R1585:Zfp804a UTSW 2 82053751 start gained probably benign
R1674:Zfp804a UTSW 2 82258824 missense probably benign 0.35
R2058:Zfp804a UTSW 2 82257366 missense probably benign 0.00
R2146:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2149:Zfp804a UTSW 2 82258664 missense probably benign 0.02
R2171:Zfp804a UTSW 2 82257183 missense possibly damaging 0.77
R2307:Zfp804a UTSW 2 82256857 missense probably benign 0.04
R2398:Zfp804a UTSW 2 82258669 missense possibly damaging 0.95
R2496:Zfp804a UTSW 2 82235844 missense probably damaging 1.00
R2504:Zfp804a UTSW 2 82257519 missense probably benign 0.00
R2919:Zfp804a UTSW 2 82235816 missense probably damaging 1.00
R2943:Zfp804a UTSW 2 82235879 missense probably damaging 1.00
R4170:Zfp804a UTSW 2 82253488 missense probably damaging 1.00
R4393:Zfp804a UTSW 2 82256921 missense probably benign 0.43
R4701:Zfp804a UTSW 2 82256582 missense probably damaging 1.00
R4771:Zfp804a UTSW 2 82257942 missense probably benign 0.01
R4793:Zfp804a UTSW 2 82235842 missense probably damaging 1.00
R5523:Zfp804a UTSW 2 82258995 missense probably damaging 1.00
R5526:Zfp804a UTSW 2 82258590 missense probably benign 0.00
R5961:Zfp804a UTSW 2 82258002 missense probably benign
R6181:Zfp804a UTSW 2 82257142 missense probably damaging 1.00
R6209:Zfp804a UTSW 2 82258118 missense probably damaging 1.00
R6325:Zfp804a UTSW 2 82257038 missense possibly damaging 0.80
R7147:Zfp804a UTSW 2 82258187 missense probably benign 0.00
R7229:Zfp804a UTSW 2 82258625 missense probably benign 0.04
R7666:Zfp804a UTSW 2 82259060 nonsense probably null
R7910:Zfp804a UTSW 2 82256573 missense probably damaging 1.00
R8256:Zfp804a UTSW 2 82053849 missense probably damaging 0.99
X0064:Zfp804a UTSW 2 82235823 missense probably damaging 1.00
Z1177:Zfp804a UTSW 2 82258563 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTGTAGGACCTAGGCTTTGTC -3'
(R):5'- ATAGGGTCATCAGCTTTGTCTAAAC -3'

Sequencing Primer
(F):5'- GACCTAGGCTTTGTCCTGGC -3'
(R):5'- GCTTTGTCTAAACATTAAATAGGTGC -3'
Posted On2015-02-05