Incidental Mutation 'R6343:Fdft1'
ID514021
Institutional Source Beutler Lab
Gene Symbol Fdft1
Ensembl Gene ENSMUSG00000021273
Gene Namefarnesyl diphosphate farnesyl transferase 1
Synonymssqualene synthase, SQS, Ss
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location63145150-63179578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63151272 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 304 (Y304N)
Ref Sequence ENSEMBL: ENSMUSP00000153671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054963] [ENSMUST00000224625]
Predicted Effect probably damaging
Transcript: ENSMUST00000054963
AA Change: Y304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055313
Gene: ENSMUSG00000021273
AA Change: Y304N

DomainStartEndE-ValueType
Pfam:SQS_PSY 47 320 2.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000224625
AA Change: Y304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated enzyme located at a branch point in the mevalonate pathway. The encoded protein is the first specific enzyme in cholesterol biosynthesis, catalyzing the dimerization of two molecules of farnesyl diphosphate in a two-step reaction to form squalene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die around E9.5-10.5. Conditional homozygous null in which the gene is deleted specifically in oligodendrocyte and Schwann cell display dysmyelination of spinal cord and brain white matter, and showed ataxia and tremor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Fdft1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Fdft1 APN 14 63163389 nonsense probably null
PIT4515001:Fdft1 UTSW 14 63164583 missense probably benign 0.30
R0012:Fdft1 UTSW 14 63177698 missense probably benign 0.03
R0442:Fdft1 UTSW 14 63163349 missense probably benign 0.29
R0735:Fdft1 UTSW 14 63163420 missense probably damaging 1.00
R1674:Fdft1 UTSW 14 63164585 missense probably benign 0.20
R1689:Fdft1 UTSW 14 63156689 missense probably benign 0.00
R3116:Fdft1 UTSW 14 63177698 missense probably benign 0.03
R3418:Fdft1 UTSW 14 63156621 missense probably damaging 1.00
R5033:Fdft1 UTSW 14 63163404 missense probably damaging 1.00
R5274:Fdft1 UTSW 14 63152343 missense probably damaging 1.00
R5371:Fdft1 UTSW 14 63151301 missense probably damaging 1.00
R5747:Fdft1 UTSW 14 63146839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGGTTAAACAGCGAC -3'
(R):5'- GGCTAAATGACAGAATAACCCTGTTG -3'

Sequencing Primer
(F):5'- GGTTAAACAGCGACATGATTTAATGC -3'
(R):5'- GAGCTGAAAAGGTCGAGCC -3'
Posted On2018-04-27