Incidental Mutation 'R2931:Map2k4'
ID264539
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
MMRRC Submission 040513-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65756337 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 59 (N59K)
Ref Sequence ENSEMBL: ENSMUSP00000137819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000130009] [ENSMUST00000140301] [ENSMUST00000152096]
Predicted Effect probably benign
Transcript: ENSMUST00000046963
AA Change: N48K

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352
AA Change: N48K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130009
AA Change: N59K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137819
Gene: ENSMUSG00000033352
AA Change: N59K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000140301
AA Change: N48K
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352
AA Change: N48K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152096
AA Change: N59K

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114219
Gene: ENSMUSG00000033352
AA Change: N59K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 111 202 2.5e-9 PFAM
Pfam:Pkinase 111 204 1e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb C T 10: 10,442,502 V193I possibly damaging Het
Asb2 T C 12: 103,334,887 D151G probably damaging Het
Cyp2c69 G A 19: 39,849,483 T385I probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dido1 T C 2: 180,661,653 E1486G probably damaging Het
Kdm5d T C Y: 942,992 F1492L probably benign Het
Myo18b A G 5: 112,693,127 S2267P probably benign Het
Naip2 A T 13: 100,155,021 D1136E probably benign Het
Otogl A T 10: 107,820,004 M1080K possibly damaging Het
Pirb A T 7: 3,717,206 H389Q probably benign Het
Sptan1 A G 2: 30,018,488 T1739A probably benign Het
Strip1 T A 3: 107,625,659 probably null Het
Trappc11 A T 8: 47,503,942 D816E probably damaging Het
Zscan12 A G 13: 21,364,017 D123G possibly damaging Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2073:Map2k4 UTSW 11 65693456 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R4913:Map2k4 UTSW 11 65709932 missense probably damaging 1.00
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5497:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5812:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCACTATTTTCCCAAGTAGAC -3'
(R):5'- TTGGTACCTTTTCAAGCATTGC -3'

Sequencing Primer
(F):5'- AGCCCTGCATTTAGTCAC -3'
(R):5'- ACCTTTTCAAGCATTGCTCTATATTG -3'
Posted On2015-02-05