Incidental Mutation 'R3420:Nuak2'
ID266994
Institutional Source Beutler Lab
Gene Symbol Nuak2
Ensembl Gene ENSMUSG00000009772
Gene NameNUAK family, SNF1-like kinase, 2
SynonymsSnark, 1200013B22Rik
MMRRC Submission 040638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R3420 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location132316126-132333488 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132332080 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 532 (D532G)
Ref Sequence ENSEMBL: ENSMUSP00000080769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072177] [ENSMUST00000082125]
Predicted Effect probably benign
Transcript: ENSMUST00000072177
AA Change: D540G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072039
Gene: ENSMUSG00000009772
AA Change: D540G

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 315 5.53e-99 SMART
low complexity region 471 485 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082125
AA Change: D532G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080769
Gene: ENSMUSG00000009772
AA Change: D532G

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
S_TKc 57 307 6.1e-106 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133246
Meta Mutation Damage Score 0.0767 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Most homozygous null mice are exencephalic and die at E16.5 while survivors show a higher number of azoxymethane (AOM)-induced aberrant crypt foci (ACF) in colon. Heterozygotes show increased susceptibility to AOM-induced ACF formation and colon tumors, mature-onset obesity and metabolic disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Celsr2 A G 3: 108,414,416 V360A probably benign Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cyp2b9 G A 7: 26,210,103 G432E probably damaging Het
Dclre1b A G 3: 103,808,096 Y29H probably damaging Het
Enthd1 T C 15: 80,560,024 D110G probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Klb G A 5: 65,372,142 G338S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Prps2 G A X: 167,382,508 probably null Het
Prss23 C A 7: 89,509,899 V321L possibly damaging Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Washc1 T C 17: 66,117,033 S247P probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Other mutations in Nuak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01607:Nuak2 APN 1 132328140 missense probably damaging 1.00
IGL01660:Nuak2 APN 1 132331570 missense probably benign 0.12
IGL02093:Nuak2 APN 1 132332112 missense probably benign
IGL02731:Nuak2 APN 1 132316357 missense probably damaging 1.00
IGL03231:Nuak2 APN 1 132328177 missense probably damaging 1.00
R0547:Nuak2 UTSW 1 132332203 missense probably benign 0.09
R1972:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R1973:Nuak2 UTSW 1 132330602 missense probably damaging 0.98
R2897:Nuak2 UTSW 1 132325053 missense probably damaging 1.00
R3421:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3422:Nuak2 UTSW 1 132332080 missense probably benign 0.00
R3890:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3891:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R3892:Nuak2 UTSW 1 132331485 missense possibly damaging 0.79
R4899:Nuak2 UTSW 1 132324986 nonsense probably null
R5068:Nuak2 UTSW 1 132331771 missense probably benign 0.04
R6243:Nuak2 UTSW 1 132332367 missense probably benign 0.01
R6310:Nuak2 UTSW 1 132329961 missense probably damaging 1.00
R6505:Nuak2 UTSW 1 132316394 missense probably damaging 1.00
R6694:Nuak2 UTSW 1 132332310 missense probably damaging 1.00
R6966:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7569:Nuak2 UTSW 1 132316281 missense possibly damaging 0.85
R7708:Nuak2 UTSW 1 132325032 missense possibly damaging 0.95
R7879:Nuak2 UTSW 1 132331957 missense probably benign
R7962:Nuak2 UTSW 1 132331957 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGGAACTCTTAGACGC -3'
(R):5'- GTCAGAGAAAAGCAGCTATCCC -3'

Sequencing Primer
(F):5'- ACTCTTAGACGCCAGTGATG -3'
(R):5'- AGGATTCCTGCCACCATCG -3'
Posted On2015-02-18