Incidental Mutation 'R3420:Prss23'
ID267012
Institutional Source Beutler Lab
Gene Symbol Prss23
Ensembl Gene ENSMUSG00000039405
Gene Nameprotease, serine 23
Synonyms2310046G15Rik
MMRRC Submission 040638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3420 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89507783-89527187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89509899 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 321 (V321L)
Ref Sequence ENSEMBL: ENSMUSP00000147183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041761] [ENSMUST00000207538] [ENSMUST00000207636] [ENSMUST00000207932] [ENSMUST00000208402] [ENSMUST00000208888] [ENSMUST00000208903]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032858
Predicted Effect possibly damaging
Transcript: ENSMUST00000041761
AA Change: V321L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045191
Gene: ENSMUSG00000039405
AA Change: V321L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 48 57 N/A INTRINSIC
Tryp_SPc 137 372 2.87e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179361
Predicted Effect probably benign
Transcript: ENSMUST00000207538
Predicted Effect probably benign
Transcript: ENSMUST00000207636
Predicted Effect possibly damaging
Transcript: ENSMUST00000207932
AA Change: V321L

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000208402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208814
Predicted Effect probably benign
Transcript: ENSMUST00000208888
Predicted Effect probably benign
Transcript: ENSMUST00000208903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209118
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels of this gene after ovulation was induced. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl3 A G 6: 34,793,965 T132A probably benign Het
Amn1 A T 6: 149,169,452 L196* probably null Het
Ccdc73 A T 2: 104,951,947 K216M probably null Het
Ccdc73 G A 2: 104,951,948 probably null Het
Celsr2 A G 3: 108,414,416 V360A probably benign Het
Ckap5 T A 2: 91,570,252 W650R probably damaging Het
Cyp2b9 G A 7: 26,210,103 G432E probably damaging Het
Dclre1b A G 3: 103,808,096 Y29H probably damaging Het
Enthd1 T C 15: 80,560,024 D110G probably damaging Het
Fam19a1 C A 6: 96,649,138 D112E probably damaging Het
Grin1 C T 2: 25,303,914 G390D probably damaging Het
Hoxc6 T A 15: 103,010,895 W188R probably damaging Het
Kcnip1 A G 11: 33,645,594 V43A probably damaging Het
Kifap3 T A 1: 163,794,026 I81N probably damaging Het
Klb G A 5: 65,372,142 G338S probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nuak2 A G 1: 132,332,080 D532G probably benign Het
Olfr26 A G 9: 38,855,325 K88E possibly damaging Het
Prps2 G A X: 167,382,508 probably null Het
Psmb2 T C 4: 126,677,837 M28T probably damaging Het
Ric1 T C 19: 29,567,590 I230T probably damaging Het
Slc25a17 C T 15: 81,360,700 V11I probably benign Het
Slc5a4a T C 10: 76,176,573 V359A probably benign Het
Slco1a5 A T 6: 142,268,238 D52E possibly damaging Het
Tlr4 A G 4: 66,839,536 I189V probably benign Het
Washc1 T C 17: 66,117,033 S247P probably damaging Het
Zdhhc14 T A 17: 5,753,091 *490R probably null Het
Zfp217 A G 2: 170,120,017 F130S possibly damaging Het
Other mutations in Prss23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Prss23 APN 7 89509887 missense possibly damaging 0.83
IGL03308:Prss23 APN 7 89509730 missense probably benign 0.09
IGL03349:Prss23 APN 7 89509857 missense probably benign 0.09
IGL03378:Prss23 APN 7 89510144 missense probably damaging 0.99
R0394:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R1026:Prss23 UTSW 7 89509958 missense probably benign 0.01
R1417:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1467:Prss23 UTSW 7 89510009 missense probably damaging 1.00
R1691:Prss23 UTSW 7 89510714 missense probably benign 0.18
R1806:Prss23 UTSW 7 89510391 missense probably damaging 1.00
R2153:Prss23 UTSW 7 89509911 missense probably damaging 1.00
R3849:Prss23 UTSW 7 89509751 missense probably damaging 1.00
R4567:Prss23 UTSW 7 89510866 utr 5 prime probably benign
R4828:Prss23 UTSW 7 89509900 nonsense probably null
R5010:Prss23 UTSW 7 89510214 missense probably benign 0.25
R5251:Prss23 UTSW 7 89510322 missense probably damaging 1.00
R5399:Prss23 UTSW 7 89509966 missense probably benign 0.02
R5629:Prss23 UTSW 7 89510192 missense probably damaging 1.00
R5697:Prss23 UTSW 7 89509982 missense probably damaging 0.99
R6378:Prss23 UTSW 7 89510033 missense probably damaging 1.00
R6716:Prss23 UTSW 7 89509847 missense probably damaging 1.00
R6880:Prss23 UTSW 7 89510825 missense probably benign 0.03
R7097:Prss23 UTSW 7 89510184 missense probably damaging 1.00
R7362:Prss23 UTSW 7 89509764 missense probably damaging 1.00
R7563:Prss23 UTSW 7 89509830 missense probably damaging 1.00
R7637:Prss23 UTSW 7 89510246 missense probably benign 0.00
R7815:Prss23 UTSW 7 89510045 missense probably damaging 0.99
R8047:Prss23 UTSW 7 89509928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCATTGGTGCTGGCAAG -3'
(R):5'- GAAGATTGGTGTGAGTCCTCC -3'

Sequencing Primer
(F):5'- CCATTGGTGCTGGCAAGAAGAC -3'
(R):5'- TGTGAGTCCTCCAGCGAAG -3'
Posted On2015-02-18