Incidental Mutation 'R3795:Zbp1'
ID272712
Institutional Source Beutler Lab
Gene Symbol Zbp1
Ensembl Gene ENSMUSG00000027514
Gene NameZ-DNA binding protein 1
SynonymsDai, mZaDLM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3795 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173206612-173218923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173212179 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 183 (H183R)
Ref Sequence ENSEMBL: ENSMUSP00000029018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029018] [ENSMUST00000109116]
Predicted Effect probably benign
Transcript: ENSMUST00000029018
AA Change: H183R

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029018
Gene: ENSMUSG00000027514
AA Change: H183R

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Pfam:RHIM 163 202 1.8e-8 PFAM
Pfam:RHIM 208 258 1.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109116
SMART Domains Protein: ENSMUSP00000104744
Gene: ENSMUSG00000027514

DomainStartEndE-ValueType
Zalpha 6 72 5.32e-23 SMART
Zalpha 82 147 7.64e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146802
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display normal innate immune activation by double-stranded B-form DNA (B-DNA) as well as normal adaptive immune responses to DNA vaccination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,030,565 T426A probably benign Het
9130204L05Rik T C 3: 91,088,423 I57M possibly damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adh1 T A 3: 138,279,765 L18H possibly damaging Het
Capn13 C A 17: 73,337,392 V381L probably benign Het
Cfap54 T C 10: 92,942,873 probably benign Het
Cmas T A 6: 142,767,868 D206E probably benign Het
Cntnap1 A G 11: 101,186,764 E1084G probably damaging Het
Cpz A G 5: 35,511,749 V346A probably benign Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dhrs3 A G 4: 144,919,392 D116G probably damaging Het
Gm11639 A G 11: 104,733,675 E844G possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Lhx2 T C 2: 38,353,347 C12R probably damaging Het
Map3k2 T C 18: 32,226,648 M518T probably benign Het
Mrc1 T A 2: 14,288,982 probably benign Het
Nlrp4e T A 7: 23,320,803 D238E probably benign Het
Obscn A G 11: 59,031,841 Y6543H probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Psg20 A G 7: 18,684,449 V131A probably benign Het
Ptpro T C 6: 137,380,309 F266S probably benign Het
Sdk2 G A 11: 113,856,696 R663* probably null Het
Szt2 G T 4: 118,391,730 L586I probably damaging Het
Tln2 T C 9: 67,255,915 I1113V probably damaging Het
Ube2ql1 G T 13: 69,704,112 A282E possibly damaging Het
Vmn2r50 T A 7: 10,037,924 M617L probably benign Het
Wdfy3 A G 5: 101,937,600 V676A probably damaging Het
Wdr47 T C 3: 108,624,737 probably null Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Zfp988 G A 4: 147,331,583 R158Q possibly damaging Het
Other mutations in Zbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Zbp1 APN 2 173212245 missense possibly damaging 0.95
IGL01924:Zbp1 APN 2 173212254 missense probably benign 0.09
IGL02804:Zbp1 APN 2 173209146 missense probably damaging 1.00
PIT4362001:Zbp1 UTSW 2 173216990 missense probably damaging 1.00
R2100:Zbp1 UTSW 2 173209244 missense probably damaging 1.00
R2269:Zbp1 UTSW 2 173218823 start gained probably benign
R4649:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4653:Zbp1 UTSW 2 173207815 missense possibly damaging 0.56
R4792:Zbp1 UTSW 2 173209213 missense probably damaging 1.00
R4807:Zbp1 UTSW 2 173212206 missense probably damaging 1.00
R5899:Zbp1 UTSW 2 173210547 missense probably benign 0.29
R6290:Zbp1 UTSW 2 173215841 missense probably damaging 1.00
R6705:Zbp1 UTSW 2 173213887 nonsense probably null
R6835:Zbp1 UTSW 2 173213911 critical splice acceptor site probably null
R7269:Zbp1 UTSW 2 173213872 missense unknown
R7337:Zbp1 UTSW 2 173218753 nonsense probably null
R7419:Zbp1 UTSW 2 173209165 missense probably benign 0.00
R7429:Zbp1 UTSW 2 173213818 missense unknown
R7508:Zbp1 UTSW 2 173207811 missense possibly damaging 0.72
R8021:Zbp1 UTSW 2 173209210 missense possibly damaging 0.78
Z1177:Zbp1 UTSW 2 173207741 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTTTTGATCTCATTGAGAAGGAG -3'
(R):5'- TTCAGGTGTCAGCAAGCTCC -3'

Sequencing Primer
(F):5'- TCACTCTGAGAAAGGCCGTG -3'
(R):5'- CAAGCTCCCAGGGAAGTTCAG -3'
Posted On2015-03-25