Incidental Mutation 'R3795:Cmas'
ID272726
Institutional Source Beutler Lab
Gene Symbol Cmas
Ensembl Gene ENSMUSG00000030282
Gene Namecytidine monophospho-N-acetylneuraminic acid synthetase
SynonymsCMP-Neu5Ac synthase, CMP-sialic acid synthetase, D6Bwg0250e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R3795 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142756686-142775714 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142767868 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 206 (D206E)
Ref Sequence ENSEMBL: ENSMUSP00000032419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032419] [ENSMUST00000133248] [ENSMUST00000144920]
Predicted Effect probably benign
Transcript: ENSMUST00000032419
AA Change: D206E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032419
Gene: ENSMUSG00000030282
AA Change: D206E

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 301 3.8e-69 PFAM
Pfam:NTP_transf_3 45 228 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133248
SMART Domains Protein: ENSMUSP00000144875
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144920
SMART Domains Protein: ENSMUSP00000145392
Gene: ENSMUSG00000030282

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:CTP_transf_3 44 85 2.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146643
Predicted Effect probably benign
Transcript: ENSMUST00000204147
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that converts N-acetylneuraminic acid (NeuNAc) to cytidine 5'-monophosphate N-acetylneuraminic acid (CMP-NeuNAc). This process is important in the formation of sialylated glycoprotein and glycolipids. This modification plays a role in cell-cell communications and immune responses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,030,565 T426A probably benign Het
9130204L05Rik T C 3: 91,088,423 I57M possibly damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adh1 T A 3: 138,279,765 L18H possibly damaging Het
Capn13 C A 17: 73,337,392 V381L probably benign Het
Cfap54 T C 10: 92,942,873 probably benign Het
Cntnap1 A G 11: 101,186,764 E1084G probably damaging Het
Cpz A G 5: 35,511,749 V346A probably benign Het
D430042O09Rik A G 7: 125,820,089 N476S probably benign Het
Dhrs3 A G 4: 144,919,392 D116G probably damaging Het
Gm11639 A G 11: 104,733,675 E844G possibly damaging Het
Inpp4b T C 8: 82,033,216 V445A probably damaging Het
Lhx2 T C 2: 38,353,347 C12R probably damaging Het
Map3k2 T C 18: 32,226,648 M518T probably benign Het
Mrc1 T A 2: 14,288,982 probably benign Het
Nlrp4e T A 7: 23,320,803 D238E probably benign Het
Obscn A G 11: 59,031,841 Y6543H probably damaging Het
Pigv A G 4: 133,665,191 S223P possibly damaging Het
Pkdcc A G 17: 83,223,953 T464A probably damaging Het
Polr2k A G 15: 36,175,047 I18V probably damaging Het
Psg20 A G 7: 18,684,449 V131A probably benign Het
Ptpro T C 6: 137,380,309 F266S probably benign Het
Sdk2 G A 11: 113,856,696 R663* probably null Het
Szt2 G T 4: 118,391,730 L586I probably damaging Het
Tln2 T C 9: 67,255,915 I1113V probably damaging Het
Ube2ql1 G T 13: 69,704,112 A282E possibly damaging Het
Vmn2r50 T A 7: 10,037,924 M617L probably benign Het
Wdfy3 A G 5: 101,937,600 V676A probably damaging Het
Wdr47 T C 3: 108,624,737 probably null Het
Zbp1 T C 2: 173,212,179 H183R probably benign Het
Zfp352 C T 4: 90,225,149 H509Y probably damaging Het
Zfp988 G A 4: 147,331,583 R158Q possibly damaging Het
Other mutations in Cmas
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0558:Cmas UTSW 6 142775244 nonsense probably null
R0798:Cmas UTSW 6 142764656 missense probably damaging 1.00
R1172:Cmas UTSW 6 142756878 missense probably benign 0.01
R1453:Cmas UTSW 6 142772127 missense probably damaging 1.00
R1983:Cmas UTSW 6 142770586 missense probably damaging 0.98
R2147:Cmas UTSW 6 142771289 missense probably benign 0.18
R4378:Cmas UTSW 6 142772285 unclassified probably benign
R4768:Cmas UTSW 6 142764431 critical splice donor site probably null
R6430:Cmas UTSW 6 142767924 missense probably benign
R6774:Cmas UTSW 6 142764421 missense possibly damaging 0.81
R6824:Cmas UTSW 6 142771236 missense possibly damaging 0.90
R6980:Cmas UTSW 6 142756800 missense probably damaging 0.97
R7256:Cmas UTSW 6 142770586 missense probably damaging 1.00
R7776:Cmas UTSW 6 142764557 missense probably damaging 0.99
R7969:Cmas UTSW 6 142775166 missense probably damaging 1.00
R8325:Cmas UTSW 6 142771339 critical splice donor site probably null
R8363:Cmas UTSW 6 142756828 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CAGATGTCTGCATTCTGAGGG -3'
(R):5'- AGTGTTCCACTGAGCAGAC -3'

Sequencing Primer
(F):5'- CTGCATTCTGAGGGGAGTTTTATTTG -3'
(R):5'- GACTACACAGACAGTTCCTGGG -3'
Posted On2015-03-25