Incidental Mutation 'R3859:Dnajc5b'
ID276279
Institutional Source Beutler Lab
Gene Symbol Dnajc5b
Ensembl Gene ENSMUSG00000027606
Gene NameDnaJ heat shock protein family (Hsp40) member C5 beta
Synonyms
MMRRC Submission 040787-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3859 (G1)
Quality Score128
Status Not validated
Chromosome3
Chromosomal Location19508595-19610862 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 19574802 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 87 (G87*)
Ref Sequence ENSEMBL: ENSMUSP00000127515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029132] [ENSMUST00000118735] [ENSMUST00000118968] [ENSMUST00000165693]
Predicted Effect probably null
Transcript: ENSMUST00000029132
AA Change: G87*
SMART Domains Protein: ENSMUSP00000029132
Gene: ENSMUSG00000027606
AA Change: G87*

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118735
AA Change: G87*
SMART Domains Protein: ENSMUSP00000113414
Gene: ENSMUSG00000027606
AA Change: G87*

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118968
AA Change: G87*
SMART Domains Protein: ENSMUSP00000112849
Gene: ENSMUSG00000027606
AA Change: G87*

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165693
AA Change: G87*
SMART Domains Protein: ENSMUSP00000127515
Gene: ENSMUSG00000027606
AA Change: G87*

DomainStartEndE-ValueType
DnaJ 18 76 2.12e-26 SMART
transmembrane domain 112 134 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of co-chaperone proteins that is characterized by an N-terminal DNAJ domain, a linker region, and a cysteine-rich C-terminal domain. The encoded protein, together with heat shock protein 70, is thought to regulate the proper folding of other proteins. The orthologous mouse protein is membrane-associated and is targeted to the trans-golgi network. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot4 A G 12: 84,043,444 N305S probably benign Het
Ahnak A G 19: 9,010,859 E3169G possibly damaging Het
AU022751 A G X: 6,082,656 S102P possibly damaging Het
Cav2 G T 6: 17,281,463 D35Y probably damaging Het
Cps1 A G 1: 67,168,278 Y582C probably damaging Het
Ctla2b T A 13: 60,896,043 Y128F possibly damaging Het
Erc2 A G 14: 28,475,642 probably benign Het
Fat3 G A 9: 15,997,228 Q2493* probably null Het
Fbl G A 7: 28,174,510 probably benign Het
Fbp1 C T 13: 62,865,116 G88S probably damaging Het
Fzd3 A T 14: 65,239,839 C89S possibly damaging Het
Gnao1 C T 8: 93,811,645 probably benign Het
Hspa14 A T 2: 3,494,579 C304* probably null Het
Itih4 T C 14: 30,892,329 L412P probably damaging Het
Kdm2b A G 5: 122,880,227 L995P probably damaging Het
Krt12 G A 11: 99,418,493 L314F possibly damaging Het
Nfatc1 T C 18: 80,665,275 probably benign Het
Olfr1216 A G 2: 89,014,061 M1T probably null Het
Olfr1475 T A 19: 13,480,130 I23F possibly damaging Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Papss1 T A 3: 131,607,335 L349Q probably benign Het
Pcdha6 C T 18: 36,969,931 P6S possibly damaging Het
Pik3r2 T C 8: 70,769,986 E487G probably damaging Het
Pkd1 A G 17: 24,578,092 probably benign Het
Prl8a9 C T 13: 27,558,164 G238E probably damaging Het
Pth2r A T 1: 65,322,047 I52F probably damaging Het
Purg T C 8: 33,386,559 F75S possibly damaging Het
Rpgrip1l T C 8: 91,263,658 T719A probably benign Het
Slc8a3 G A 12: 81,314,872 P391L probably damaging Het
Syne2 T C 12: 75,929,784 L1241P possibly damaging Het
Tdrd12 A G 7: 35,493,820 F402L possibly damaging Het
Tle4 G A 19: 14,468,213 T223I probably benign Het
Tmem2 A G 19: 21,852,234 T1236A probably benign Het
Tram2 A C 1: 21,003,980 F245V probably damaging Het
Trim30b T C 7: 104,357,280 E123G probably benign Het
Unc13c G T 9: 73,699,108 Y1323* probably null Het
Zfp2 T C 11: 50,900,096 I373M possibly damaging Het
Other mutations in Dnajc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1630:Dnajc5b UTSW 3 19574741 missense probably damaging 1.00
R1714:Dnajc5b UTSW 3 19579101 nonsense probably null
R3011:Dnajc5b UTSW 3 19546802 missense probably damaging 1.00
R5268:Dnajc5b UTSW 3 19579060 missense probably benign 0.00
R5281:Dnajc5b UTSW 3 19610560 missense probably benign 0.37
R5337:Dnajc5b UTSW 3 19574782 missense probably damaging 1.00
R5929:Dnajc5b UTSW 3 19546855 missense probably damaging 1.00
R7081:Dnajc5b UTSW 3 19546861 critical splice donor site probably null
R7770:Dnajc5b UTSW 3 19579017 missense probably benign 0.19
R7782:Dnajc5b UTSW 3 19574842 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGAGCTAATACTTTTCTCCTTGC -3'
(R):5'- CAGCTTTCAGAGGAAGCGATG -3'

Sequencing Primer
(F):5'- CATCTGCTGCTGAGAAGTT -3'
(R):5'- CGATGTCGCATTTTATTTACAAGAG -3'
Posted On2015-04-06