Incidental Mutation 'R3873:Ly6g6e'
ID276697
Institutional Source Beutler Lab
Gene Symbol Ly6g6e
Ensembl Gene ENSMUSG00000013766
Gene Namelymphocyte antigen 6 complex, locus G6E
Synonyms2310011I02Rik, G6e
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3873 (G1)
Quality Score155
Status Validated
Chromosome17
Chromosomal Location35076902-35078804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35077183 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 10 (V10A)
Ref Sequence ENSEMBL: ENSMUSP00000133753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007259] [ENSMUST00000013910] [ENSMUST00000038507] [ENSMUST00000172494] [ENSMUST00000172678] [ENSMUST00000172959]
Predicted Effect probably benign
Transcript: ENSMUST00000007259
SMART Domains Protein: ENSMUSP00000007259
Gene: ENSMUSG00000073413

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000013910
AA Change: V10A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000013910
Gene: ENSMUSG00000013766
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 28 117 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038507
SMART Domains Protein: ENSMUSP00000046380
Gene: ENSMUSG00000034923

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 21 127 6.02e-7 SMART
transmembrane domain 237 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172494
AA Change: V10A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133645
Gene: ENSMUSG00000013766
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:LU 28 50 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172639
Predicted Effect probably benign
Transcript: ENSMUST00000172678
AA Change: V10A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134073
Gene: ENSMUSG00000013766
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LU 28 117 1.65e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172903
Predicted Effect probably benign
Transcript: ENSMUST00000172959
AA Change: V10A

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133753
Gene: ENSMUSG00000013766
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Activin_recp 82 143 2.3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173120
Meta Mutation Damage Score 0.1895 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Ly6g6e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03376:Ly6g6e APN 17 35078232 makesense probably null
R0798:Ly6g6e UTSW 17 35078041 missense probably benign 0.00
R1186:Ly6g6e UTSW 17 35078008 missense probably benign 0.01
R2043:Ly6g6e UTSW 17 35077864 missense possibly damaging 0.66
R2420:Ly6g6e UTSW 17 35078146 missense probably benign 0.07
R2421:Ly6g6e UTSW 17 35078146 missense probably benign 0.07
R2422:Ly6g6e UTSW 17 35078146 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CATAGGGCTGTTGCATGAGG -3'
(R):5'- AGAGCTCTTCTCAAATGCTCC -3'

Sequencing Primer
(F):5'- ATGAGGCAGGCCAATCTCTC -3'
(R):5'- GCCTTCTGAGACATAGCTCTACATAG -3'
Posted On2015-04-06