Incidental Mutation 'R3873:Vipr2'
ID276685
Institutional Source Beutler Lab
Gene Symbol Vipr2
Ensembl Gene ENSMUSG00000011171
Gene Namevasoactive intestinal peptide receptor 2
SynonymsVPAC2R, VPAC2, VIP receptor subtype 2, Vip2
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116077726-116146261 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 116136104 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000011315]
Predicted Effect probably benign
Transcript: ENSMUST00000011315
SMART Domains Protein: ENSMUSP00000011315
Gene: ENSMUSG00000011171

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 47 117 8.35e-25 SMART
Pfam:7tm_2 122 370 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176078
Predicted Effect probably benign
Transcript: ENSMUST00000176433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177199
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for vasoactive intestinal peptide, a small neuropeptide. Vasoactive intestinal peptide is involved in smooth muscle relaxation, exocrine and endocrine secretion, and water and ion flux in lung and intestinal epithelia. Its actions are effected through integral membrane receptors associated with a guanine nucleotide binding protein which activates adenylate cyclase. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit enhanced delayed-type hypersensitivity (type IV) and reduced immediate-type hypersensitivity (type I). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Vipr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Vipr2 APN 12 116138748 splice site probably null
IGL02233:Vipr2 APN 12 116094736 missense probably damaging 0.99
IGL02691:Vipr2 APN 12 116136229 missense probably benign 0.11
PIT4377001:Vipr2 UTSW 12 116094798 missense probably benign 0.01
R0135:Vipr2 UTSW 12 116142827 missense probably benign 0.00
R0207:Vipr2 UTSW 12 116142882 missense probably damaging 1.00
R1389:Vipr2 UTSW 12 116137330 missense probably benign 0.01
R1560:Vipr2 UTSW 12 116094781 missense probably benign 0.18
R1575:Vipr2 UTSW 12 116144272 missense probably benign
R1696:Vipr2 UTSW 12 116139157 missense probably benign 0.13
R1970:Vipr2 UTSW 12 116136206 missense probably benign 0.01
R2010:Vipr2 UTSW 12 116122810 critical splice donor site probably null
R4713:Vipr2 UTSW 12 116080131 missense probably benign 0.00
R4953:Vipr2 UTSW 12 116144256 missense probably benign 0.07
R6041:Vipr2 UTSW 12 116142984 missense probably damaging 1.00
R6337:Vipr2 UTSW 12 116122743 nonsense probably null
R6902:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R6946:Vipr2 UTSW 12 116139199 missense possibly damaging 0.46
R7763:Vipr2 UTSW 12 116122718 missense probably damaging 1.00
X0066:Vipr2 UTSW 12 116142945 splice site probably null
X0067:Vipr2 UTSW 12 116139172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATCAGAGAATCAGAGGCTCC -3'
(R):5'- ATGGAGAATATGAAGCCCTTACCC -3'

Sequencing Primer
(F):5'- AATCAGAGGCTCCCTGCAGATG -3'
(R):5'- CCATCCGATCAGAAGGTAGGC -3'
Posted On2015-04-06