Incidental Mutation 'R4008:Adsl'
ID311579
Institutional Source Beutler Lab
Gene Symbol Adsl
Ensembl Gene ENSMUSG00000022407
Gene Nameadenylosuccinate lyase
Synonyms
MMRRC Submission 040946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4008 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80948490-80970946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80966156 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 359 (S359P)
Ref Sequence ENSEMBL: ENSMUSP00000131998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023043] [ENSMUST00000164806] [ENSMUST00000166711] [ENSMUST00000168756] [ENSMUST00000169238] [ENSMUST00000200201] [ENSMUST00000207170]
Predicted Effect probably benign
Transcript: ENSMUST00000023043
AA Change: S359P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000023043
Gene: ENSMUSG00000022407
AA Change: S359P

DomainStartEndE-ValueType
Pfam:Lyase_1 49 313 4.4e-29 PFAM
ADSL_C 377 461 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163575
Predicted Effect probably benign
Transcript: ENSMUST00000164806
AA Change: S359P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131998
Gene: ENSMUSG00000022407
AA Change: S359P

DomainStartEndE-ValueType
Pfam:Lyase_1 47 313 8.4e-29 PFAM
Blast:ADSL_C 377 416 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000166711
SMART Domains Protein: ENSMUSP00000129601
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168756
AA Change: S344P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000127593
Gene: ENSMUSG00000022407
AA Change: S344P

DomainStartEndE-ValueType
Pfam:Lyase_1 115 298 3.9e-25 PFAM
ADSL_C 362 446 5.65e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169238
SMART Domains Protein: ENSMUSP00000132423
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 134 3e-87 PDB
SCOP:d1c3ca_ 20 134 9e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199284
Predicted Effect probably benign
Transcript: ENSMUST00000200201
SMART Domains Protein: ENSMUSP00000143188
Gene: ENSMUSG00000022407

DomainStartEndE-ValueType
PDB:2VD6|D 1 119 6e-77 PDB
SCOP:d1c3ca_ 20 119 4e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207170
Meta Mutation Damage Score 0.1018 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: This gene encodes a protein that is involved in adenosine monophosphate (AMP) biosynthesis and maintaining AMP levels in the muscle. The encoded enzyme catalyzes the release of fumarate during AMP biosynthesis by cleaving the substrates succinylaminoimidazole carboxamide (SAICA) ribotide to give aminoimidazole carboxamide (AICA) ribotide, and adenylosuccinate to give adenylate. In humans, this gene is associated with adenylosuccinate deficiency, a rare autosomal disorder resulting in a spectrum of neurological symptoms. A pseudogene associated with this gene is located on the X chromosome. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Batf2 G A 19: 6,171,348 E63K probably damaging Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Clvs2 G A 10: 33,543,462 H199Y probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
H2-K1 G A 17: 33,999,551 probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Larp7 T C 3: 127,540,870 D490G probably benign Het
Map9 T C 3: 82,359,083 Y12H probably damaging Het
Mn1 G T 5: 111,420,169 E668D probably benign Het
Mrps18c T C 5: 100,803,116 probably benign Het
Npdc1 T A 2: 25,408,980 Y237* probably null Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr722 A G 14: 49,895,007 L265P probably benign Het
Oprm1 A G 10: 6,832,520 M388V probably benign Het
Pkn2 T C 3: 142,810,458 D568G possibly damaging Het
Pwp1 A G 10: 85,882,034 T279A possibly damaging Het
Rabep2 C A 7: 126,445,374 D547E probably damaging Het
Rbm34 T C 8: 126,949,287 K426R probably benign Het
Rgs14 T G 13: 55,369,913 L8V probably damaging Het
Ripor2 A G 13: 24,696,538 H407R probably benign Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc39a12 T C 2: 14,452,117 F603L probably damaging Het
Smg5 T C 3: 88,349,158 S244P probably benign Het
St3gal3 T C 4: 117,940,440 I252V probably benign Het
Tarsl2 T A 7: 65,678,128 D528E probably damaging Het
Try10 A G 6: 41,356,674 T118A probably benign Het
Tshr C T 12: 91,537,494 S402L probably benign Het
Other mutations in Adsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Adsl APN 15 80948700 missense probably null 0.24
IGL02249:Adsl APN 15 80960475 missense probably benign 0.26
IGL03009:Adsl APN 15 80952243 nonsense probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0046:Adsl UTSW 15 80962788 critical splice donor site probably null
R0194:Adsl UTSW 15 80961360 missense possibly damaging 0.91
R0575:Adsl UTSW 15 80963685 missense probably damaging 1.00
R1111:Adsl UTSW 15 80967660 missense probably damaging 1.00
R1606:Adsl UTSW 15 80952224 nonsense probably null
R1822:Adsl UTSW 15 80962742 nonsense probably null
R2152:Adsl UTSW 15 80967662 missense probably damaging 1.00
R2284:Adsl UTSW 15 80963895 missense probably damaging 0.99
R4010:Adsl UTSW 15 80966156 missense probably benign 0.05
R4011:Adsl UTSW 15 80966156 missense probably benign 0.05
R4202:Adsl UTSW 15 80952216 missense probably damaging 0.98
R4587:Adsl UTSW 15 80967767 critical splice donor site probably null
R5053:Adsl UTSW 15 80960450 missense probably damaging 1.00
R5086:Adsl UTSW 15 80963700 missense probably damaging 0.96
R5123:Adsl UTSW 15 80952294 unclassified probably null
R5187:Adsl UTSW 15 80948905 intron probably benign
R5416:Adsl UTSW 15 80952183 splice site probably null
R5532:Adsl UTSW 15 80963909 missense probably damaging 1.00
R5898:Adsl UTSW 15 80961353 splice site probably null
R7401:Adsl UTSW 15 80962782 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCAGCTAGAAGTGGAG -3'
(R):5'- TGTATGCACGTCTGTCTGTC -3'

Sequencing Primer
(F):5'- CTAGAAGTGGAGGAGGTAAGGGTTG -3'
(R):5'- GTCAGTTCCACAGATCTGGC -3'
Posted On2015-04-29