Incidental Mutation 'R4025:Slc22a20'
ID313465
Institutional Source Beutler Lab
Gene Symbol Slc22a20
Ensembl Gene ENSMUSG00000037451
Gene Namesolute carrier family 22 (organic anion transporter), member 20
SynonymsmOAT6, LOC381203
MMRRC Submission 040958-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R4025 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5970234-5986143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5985780 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 121 (T121A)
Ref Sequence ENSEMBL: ENSMUSP00000049473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025891] [ENSMUST00000041827] [ENSMUST00000041827] [ENSMUST00000041827] [ENSMUST00000164843]
Predicted Effect probably benign
Transcript: ENSMUST00000025891
SMART Domains Protein: ENSMUSP00000025891
Gene: ENSMUSG00000024942

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000041827
AA Change: T121A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049473
Gene: ENSMUSG00000037451
AA Change: T121A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
Pfam:Sugar_tr 100 521 2.5e-27 PFAM
Pfam:MFS_1 132 475 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041827
AA Change: T121A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049473
Gene: ENSMUSG00000037451
AA Change: T121A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
Pfam:Sugar_tr 100 521 2.5e-27 PFAM
Pfam:MFS_1 132 475 1.6e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041827
AA Change: T121A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049473
Gene: ENSMUSG00000037451
AA Change: T121A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
Pfam:Sugar_tr 100 521 2.5e-27 PFAM
Pfam:MFS_1 132 475 1.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164843
SMART Domains Protein: ENSMUSP00000127498
Gene: ENSMUSG00000024942

DomainStartEndE-ValueType
CysPc 37 362 6.79e-180 SMART
calpain_III 365 521 7.38e-94 SMART
EFh 588 616 1.13e1 SMART
EFh 618 646 2.95e0 SMART
EFh 683 711 7.65e1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc1 A T 6: 48,908,269 N646I probably damaging Het
Atad5 A G 11: 80,120,686 D1293G probably damaging Het
Cacna1a C T 8: 84,581,333 T1409I probably damaging Het
Cdk5rap2 T A 4: 70,250,387 K1428N probably damaging Het
Clcn6 T A 4: 148,014,283 T463S possibly damaging Het
Ctnna2 A T 6: 77,636,844 D254E possibly damaging Het
Fam208b T C 13: 3,584,554 D751G probably damaging Het
Fbxl7 A G 15: 26,552,819 S121P probably benign Het
Fezf2 A T 14: 12,343,986 C302S probably damaging Het
Gm9920 A G 15: 55,112,570 R25G probably benign Het
Golgb1 C T 16: 36,915,344 A1651V probably benign Het
Grk3 T A 5: 112,914,984 N666Y possibly damaging Het
Mctp2 C A 7: 72,090,239 C801F possibly damaging Het
Myo1e A G 9: 70,324,875 I229V probably benign Het
Nutm2 A G 13: 50,469,353 I29V probably benign Het
Odf2 C T 2: 29,926,815 R763W probably damaging Het
Olfr985 T C 9: 40,127,500 T154A probably benign Het
Papss2 T C 19: 32,651,923 I304T probably damaging Het
Polr2a T A 11: 69,743,659 I693F possibly damaging Het
Ppm1d T A 11: 85,345,757 I454N probably benign Het
Ranbp2 A G 10: 58,480,556 E2366G probably benign Het
Slc4a3 T C 1: 75,549,041 S262P probably damaging Het
Slfn4 A T 11: 83,187,214 N276I probably damaging Het
Spag7 C A 11: 70,664,474 E130D probably damaging Het
Spns1 A T 7: 126,376,946 C28* probably null Het
Stab1 C T 14: 31,154,952 G805D possibly damaging Het
Swi5 T C 2: 32,281,788 D41G possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uxs1 T C 1: 43,802,616 probably benign Het
Vmn1r34 T A 6: 66,637,704 M17L probably benign Het
Xirp2 A G 2: 67,511,402 D1329G probably benign Het
Other mutations in Slc22a20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Slc22a20 APN 19 5970516 missense probably benign 0.13
IGL02745:Slc22a20 APN 19 5972873 missense probably damaging 1.00
IGL02813:Slc22a20 APN 19 5984858 missense probably benign 0.00
IGL03384:Slc22a20 APN 19 5980374 nonsense probably null
R0309:Slc22a20 UTSW 19 5972957 missense probably damaging 1.00
R0762:Slc22a20 UTSW 19 5986008 missense probably damaging 0.99
R1652:Slc22a20 UTSW 19 5972942 missense probably damaging 1.00
R1670:Slc22a20 UTSW 19 5972848 splice site probably benign
R1800:Slc22a20 UTSW 19 5985667 missense probably benign 0.01
R1923:Slc22a20 UTSW 19 5971436 missense probably benign 0.00
R2202:Slc22a20 UTSW 19 5971525 missense possibly damaging 0.70
R4495:Slc22a20 UTSW 19 5984924 missense probably benign 0.27
R4751:Slc22a20 UTSW 19 5980460 missense probably benign 0.01
R6207:Slc22a20 UTSW 19 5985941 missense probably damaging 1.00
R6861:Slc22a20 UTSW 19 5971810 missense probably benign 0.01
R7243:Slc22a20 UTSW 19 5971571 missense probably damaging 1.00
R8055:Slc22a20 UTSW 19 5971411 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGTGAACGCAAGGGCTTTC -3'
(R):5'- ACCAATGTCTCAGGGGTCTG -3'

Sequencing Primer
(F):5'- GGCTCACCTGTCAGCAAG -3'
(R):5'- CTCAGGGGTCTGGCTGAG -3'
Posted On2015-04-30