Incidental Mutation 'R4173:Rora'
ID 318211
Institutional Source Beutler Lab
Gene Symbol Rora
Ensembl Gene ENSMUSG00000032238
Gene Name RAR-related orphan receptor alpha
Synonyms tmgc26, Nr1f1, 9530021D13Rik
MMRRC Submission 041012-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.911) question?
Stock # R4173 (G1)
Quality Score 84
Status Not validated
Chromosome 9
Chromosomal Location 68561068-69295528 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 68561192 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 35 (T35K)
Ref Sequence ENSEMBL: ENSMUSP00000034766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034766] [ENSMUST00000174296]
AlphaFold P51448
Predicted Effect probably benign
Transcript: ENSMUST00000034766
AA Change: T35K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034766
Gene: ENSMUSG00000032238
AA Change: T35K

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
ZnF_C4 70 141 4.71e-41 SMART
low complexity region 161 175 N/A INTRINSIC
HOLI 325 481 8.8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143507
Predicted Effect probably benign
Transcript: ENSMUST00000174296
AA Change: T7K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for null mutations exhibit ataxia, cerebellar dysgenesis, impaired Purkinje and granule cell development, olfactory defects, hypoalphalipoproteinemia, and death around 4 weeks. Heterozygotes show slow Purkinje cell dedritic atrophy and loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,306,716 (GRCm39) Q138* probably null Het
Cdk1 T C 10: 69,180,991 (GRCm39) D73G probably benign Het
Cspg4 A G 9: 56,795,214 (GRCm39) E983G probably damaging Het
Gnmt A G 17: 47,037,047 (GRCm39) V217A probably damaging Het
Myo5c A G 9: 75,153,540 (GRCm39) E142G probably damaging Het
Nr1h5 C T 3: 102,859,546 (GRCm39) R171H probably damaging Het
Opcml C T 9: 28,814,654 (GRCm39) T302I probably benign Het
Or4c58 T G 2: 89,675,122 (GRCm39) D65A probably damaging Het
Pcdha11 T C 18: 37,145,676 (GRCm39) V589A probably damaging Het
Pigl T A 11: 62,349,337 (GRCm39) F18I probably benign Het
Pip4k2b T C 11: 97,613,201 (GRCm39) K265R probably benign Het
Serpinb9e A G 13: 33,439,141 (GRCm39) N189S probably damaging Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc25a45 C A 19: 5,930,611 (GRCm39) Y99* probably null Het
Smgc T C 15: 91,744,759 (GRCm39) S655P possibly damaging Het
Thbs2 A C 17: 14,901,893 (GRCm39) probably null Het
Timd2 T C 11: 46,561,787 (GRCm39) T286A probably benign Het
Trav6d-3 A G 14: 52,962,806 (GRCm39) I14M probably benign Het
Trim28 A G 7: 12,763,805 (GRCm39) D622G probably benign Het
Txnl4b G A 8: 110,295,706 (GRCm39) V37I probably benign Het
Ubr1 C T 2: 120,777,103 (GRCm39) probably null Het
Vps13c A G 9: 67,843,595 (GRCm39) N1959D probably benign Het
Xkr4 A G 1: 3,286,711 (GRCm39) F493S probably damaging Het
Xrn2 T C 2: 146,889,612 (GRCm39) V665A probably damaging Het
Other mutations in Rora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Rora APN 9 69,278,572 (GRCm39) missense probably benign 0.31
IGL02355:Rora APN 9 69,281,374 (GRCm39) missense probably damaging 1.00
IGL02362:Rora APN 9 69,281,374 (GRCm39) missense probably damaging 1.00
PIT4696001:Rora UTSW 9 69,271,841 (GRCm39) missense possibly damaging 0.92
R0091:Rora UTSW 9 69,281,330 (GRCm39) missense probably damaging 1.00
R0555:Rora UTSW 9 69,269,028 (GRCm39) missense probably damaging 1.00
R0609:Rora UTSW 9 69,269,151 (GRCm39) missense probably damaging 1.00
R1483:Rora UTSW 9 69,271,667 (GRCm39) missense probably benign 0.00
R1712:Rora UTSW 9 69,282,771 (GRCm39) missense probably benign 0.23
R1785:Rora UTSW 9 69,284,119 (GRCm39) missense probably benign 0.30
R2883:Rora UTSW 9 69,282,717 (GRCm39) missense probably damaging 1.00
R5226:Rora UTSW 9 69,271,423 (GRCm39) intron probably benign
R5660:Rora UTSW 9 68,561,203 (GRCm39) missense probably benign 0.27
R6029:Rora UTSW 9 69,271,734 (GRCm39) missense probably benign 0.04
R6054:Rora UTSW 9 69,286,084 (GRCm39) missense probably benign 0.04
R6114:Rora UTSW 9 69,278,605 (GRCm39) missense probably benign
R6329:Rora UTSW 9 69,280,468 (GRCm39) missense probably damaging 1.00
R7028:Rora UTSW 9 69,103,365 (GRCm39) missense possibly damaging 0.46
R7170:Rora UTSW 9 69,280,472 (GRCm39) nonsense probably null
R7233:Rora UTSW 9 69,104,804 (GRCm39) nonsense probably null
R7512:Rora UTSW 9 69,281,367 (GRCm39) missense probably benign 0.00
R9647:Rora UTSW 9 69,255,450 (GRCm39) missense probably damaging 1.00
Z1176:Rora UTSW 9 69,271,654 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCATAGAGTCGCTCTGAAAAC -3'
(R):5'- AAAGTTTGCAACATTTGTGGGG -3'

Sequencing Primer
(F):5'- CCATAGAGTCGCTCTGAAAACAGAAG -3'
(R):5'- GGCACCACGATAGGCTC -3'
Posted On 2015-06-10