Incidental Mutation 'R4173:Rora'
ID318211
Institutional Source Beutler Lab
Gene Symbol Rora
Ensembl Gene ENSMUSG00000032238
Gene NameRAR-related orphan receptor alpha
Synonymstmgc26, Nr1f1, 9530021D13Rik
MMRRC Submission 041012-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R4173 (G1)
Quality Score84
Status Not validated
Chromosome9
Chromosomal Location68653786-69388246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 68653910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 35 (T35K)
Ref Sequence ENSEMBL: ENSMUSP00000034766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034766] [ENSMUST00000174296]
Predicted Effect probably benign
Transcript: ENSMUST00000034766
AA Change: T35K

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034766
Gene: ENSMUSG00000032238
AA Change: T35K

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
ZnF_C4 70 141 4.71e-41 SMART
low complexity region 161 175 N/A INTRINSIC
HOLI 325 481 8.8e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143507
Predicted Effect probably benign
Transcript: ENSMUST00000174296
AA Change: T7K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, as well as with NM23-1, the product of a tumor metastasis suppressor candidate gene. Also, it has been shown to aid in the transcriptional regulation of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for null mutations exhibit ataxia, cerebellar dysgenesis, impaired Purkinje and granule cell development, olfactory defects, hypoalphalipoproteinemia, and death around 4 weeks. Heterozygotes show slow Purkinje cell dedritic atrophy and loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdk1 T C 10: 69,345,161 D73G probably benign Het
Cspg4 A G 9: 56,887,930 E983G probably damaging Het
Gnmt A G 17: 46,726,121 V217A probably damaging Het
Myo5c A G 9: 75,246,258 E142G probably damaging Het
Nr1h5 C T 3: 102,952,230 R171H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Opcml C T 9: 28,903,358 T302I probably benign Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Pigl T A 11: 62,458,511 F18I probably benign Het
Pip4k2b T C 11: 97,722,375 K265R probably benign Het
Serpinb9e A G 13: 33,255,158 N189S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc25a45 C A 19: 5,880,583 Y99* probably null Het
Smgc T C 15: 91,860,561 S655P possibly damaging Het
Thbs2 A C 17: 14,681,631 probably null Het
Timd2 T C 11: 46,670,960 T286A probably benign Het
Trav6d-3 A G 14: 52,725,349 I14M probably benign Het
Trim28 A G 7: 13,029,878 D622G probably benign Het
Txnl4b G A 8: 109,569,074 V37I probably benign Het
Ubr1 C T 2: 120,946,622 probably null Het
Vps13c A G 9: 67,936,313 N1959D probably benign Het
Xkr4 A G 1: 3,216,488 F493S probably damaging Het
Xrn2 T C 2: 147,047,692 V665A probably damaging Het
Other mutations in Rora
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Rora APN 9 69371290 missense probably benign 0.31
IGL02355:Rora APN 9 69374092 missense probably damaging 1.00
IGL02362:Rora APN 9 69374092 missense probably damaging 1.00
PIT4696001:Rora UTSW 9 69364559 missense possibly damaging 0.92
R0091:Rora UTSW 9 69374048 missense probably damaging 1.00
R0555:Rora UTSW 9 69361746 missense probably damaging 1.00
R0609:Rora UTSW 9 69361869 missense probably damaging 1.00
R1483:Rora UTSW 9 69364385 missense probably benign 0.00
R1712:Rora UTSW 9 69375489 missense probably benign 0.23
R1785:Rora UTSW 9 69376837 missense probably benign 0.30
R2883:Rora UTSW 9 69375435 missense probably damaging 1.00
R5226:Rora UTSW 9 69364141 intron probably benign
R5660:Rora UTSW 9 68653921 missense probably benign 0.27
R6029:Rora UTSW 9 69364452 missense probably benign 0.04
R6054:Rora UTSW 9 69378802 missense probably benign 0.04
R6114:Rora UTSW 9 69371323 missense probably benign
R6329:Rora UTSW 9 69373186 missense probably damaging 1.00
R7028:Rora UTSW 9 69196083 missense possibly damaging 0.46
R7170:Rora UTSW 9 69373190 nonsense probably null
R7233:Rora UTSW 9 69197522 nonsense probably null
R7512:Rora UTSW 9 69374085 missense probably benign 0.00
Z1176:Rora UTSW 9 69364372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCATAGAGTCGCTCTGAAAAC -3'
(R):5'- AAAGTTTGCAACATTTGTGGGG -3'

Sequencing Primer
(F):5'- CCATAGAGTCGCTCTGAAAACAGAAG -3'
(R):5'- GGCACCACGATAGGCTC -3'
Posted On2015-06-10