Incidental Mutation 'R4237:6820408C15Rik'
ID321153
Institutional Source Beutler Lab
Gene Symbol 6820408C15Rik
Ensembl Gene ENSMUSG00000032680
Gene NameRIKEN cDNA 6820408C15 gene
Synonyms
MMRRC Submission 041054-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4237 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152415587-152444330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 152428953 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 32 (T32I)
Ref Sequence ENSEMBL: ENSMUSP00000037024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039961] [ENSMUST00000128737] [ENSMUST00000153713]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039961
AA Change: T32I

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037024
Gene: ENSMUSG00000032680
AA Change: T32I

DomainStartEndE-ValueType
Pfam:DUF4618 96 353 4.1e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128737
AA Change: T32I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000117627
Gene: ENSMUSG00000032680
AA Change: T32I

DomainStartEndE-ValueType
Pfam:DUF4618 97 158 1.4e-22 PFAM
Predicted Effect silent
Transcript: ENSMUST00000153713
SMART Domains Protein: ENSMUSP00000120724
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Abca13 A G 11: 9,434,188 K3880R probably benign Het
Ahnak C T 19: 9,001,783 L144F probably benign Het
Antxr2 A T 5: 97,938,407 I447N probably damaging Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Clip2 A G 5: 134,535,197 probably benign Het
Cntnap2 A T 6: 46,530,390 probably benign Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dicer1 A G 12: 104,729,228 V148A possibly damaging Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Galnt11 G A 5: 25,265,260 R569Q probably benign Het
Gpr6 T C 10: 41,070,608 N326S probably damaging Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
L3mbtl3 G A 10: 26,340,948 A181V unknown Het
Lrrc37a G A 11: 103,502,289 T770I probably damaging Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr2 T C 7: 107,001,329 N177S probably damaging Het
Olfr715 A G 7: 107,129,037 S119P probably damaging Het
Olfr850 C T 9: 19,477,597 V215I probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Ppp1r13b T C 12: 111,838,736 T181A probably benign Het
Prc1 G A 7: 80,311,216 probably benign Het
Proca1 A G 11: 78,204,926 N128S probably benign Het
Psmd8 G A 7: 29,177,121 P155L probably damaging Het
Rad54l A G 4: 116,099,449 V500A probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Serpinb10 C T 1: 107,538,449 T55M probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Tdrd9 C T 12: 112,067,625 R1334* probably null Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trim28 T A 7: 13,027,911 H268Q possibly damaging Het
Vmn2r76 T A 7: 86,230,532 I187L probably benign Het
Wdr95 A T 5: 149,563,337 R160* probably null Het
Wnt5a T C 14: 28,522,866 C357R probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Zfp184 G A 13: 21,958,778 R218H probably damaging Het
Other mutations in 6820408C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:6820408C15Rik APN 2 152442387 missense possibly damaging 0.89
IGL01986:6820408C15Rik APN 2 152441036 missense possibly damaging 0.84
IGL02153:6820408C15Rik APN 2 152441241 missense probably benign 0.06
IGL02178:6820408C15Rik APN 2 152428001 splice site probably benign
IGL03339:6820408C15Rik APN 2 152442456 missense probably damaging 1.00
R0468:6820408C15Rik UTSW 2 152441266 missense probably benign 0.01
R1624:6820408C15Rik UTSW 2 152434111 missense probably damaging 0.98
R1642:6820408C15Rik UTSW 2 152440854 missense probably damaging 1.00
R2420:6820408C15Rik UTSW 2 152429001 missense probably damaging 1.00
R3109:6820408C15Rik UTSW 2 152442456 missense probably damaging 1.00
R3153:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3154:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3875:6820408C15Rik UTSW 2 152434080 missense probably benign
R4746:6820408C15Rik UTSW 2 152440765 missense probably benign 0.13
R4957:6820408C15Rik UTSW 2 152444093 missense probably damaging 1.00
R4959:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R4973:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R5261:6820408C15Rik UTSW 2 152440857 missense probably damaging 1.00
R5399:6820408C15Rik UTSW 2 152440868 missense probably damaging 1.00
R5971:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6138:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6223:6820408C15Rik UTSW 2 152427953 missense probably benign 0.00
R6379:6820408C15Rik UTSW 2 152427992 missense probably benign 0.01
R6642:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6815:6820408C15Rik UTSW 2 152441055 missense probably benign 0.29
R8083:6820408C15Rik UTSW 2 152441067 missense possibly damaging 0.94
U15987:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGACTACTGCAGCCTTTTC -3'
(R):5'- TTGTCACACCAGTAAGCCTACC -3'

Sequencing Primer
(F):5'- TTCTTGCACCAACTCAGGGAG -3'
(R):5'- CCAGTAAGCCTACCATAATATGAATG -3'
Posted On2015-06-12