Incidental Mutation 'R2420:6820408C15Rik'
ID249184
Institutional Source Beutler Lab
Gene Symbol 6820408C15Rik
Ensembl Gene ENSMUSG00000032680
Gene NameRIKEN cDNA 6820408C15 gene
Synonyms
MMRRC Submission 040382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R2420 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location152415587-152444330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152429001 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 48 (K48R)
Ref Sequence ENSEMBL: ENSMUSP00000037024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039961] [ENSMUST00000128737] [ENSMUST00000153713]
Predicted Effect probably damaging
Transcript: ENSMUST00000039961
AA Change: K48R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037024
Gene: ENSMUSG00000032680
AA Change: K48R

DomainStartEndE-ValueType
Pfam:DUF4618 96 353 4.1e-105 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128737
AA Change: K48R

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117627
Gene: ENSMUSG00000032680
AA Change: K48R

DomainStartEndE-ValueType
Pfam:DUF4618 97 158 1.4e-22 PFAM
Predicted Effect silent
Transcript: ENSMUST00000153713
SMART Domains Protein: ENSMUSP00000120724
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik T C 5: 5,455,912 Y123C probably benign Het
Acsm2 T C 7: 119,563,634 F44L probably damaging Het
Actr5 T C 2: 158,636,081 F457S probably damaging Het
Adamts3 A G 5: 89,683,175 S1007P probably damaging Het
Ahnak C T 19: 9,009,256 P2635S possibly damaging Het
Ankrd17 A T 5: 90,289,320 D555E possibly damaging Het
Arhgap29 A G 3: 121,973,980 I24V probably benign Het
Atxn2 A T 5: 121,802,079 probably null Het
Birc6 T A 17: 74,660,614 L301Q probably damaging Het
Ccdc137 G A 11: 120,462,264 probably null Het
Ccdc18 A C 5: 108,228,588 E1298D probably damaging Het
Chst9 A T 18: 15,452,284 N407K probably damaging Het
Cwf19l2 A G 9: 3,411,341 K73E possibly damaging Het
Dhcr24 G T 4: 106,561,094 probably benign Het
Dnajc21 A G 15: 10,461,935 S127P probably benign Het
Egln1 T C 8: 124,948,246 N270S probably benign Het
Eme1 A G 11: 94,645,814 probably null Het
Emilin2 A G 17: 71,274,279 I484T possibly damaging Het
Entpd2 T C 2: 25,399,283 I259T probably benign Het
Fbp1 T C 13: 62,871,306 K24E probably benign Het
Fga A T 3: 83,033,154 N705I possibly damaging Het
Gas1 G T 13: 60,176,930 probably benign Het
Glrb A G 3: 80,860,235 I226T probably damaging Het
Gm17421 T A 12: 113,369,487 noncoding transcript Het
Gm44501 A T 17: 40,578,709 H38L possibly damaging Het
H2-M10.5 A G 17: 36,774,999 I308V probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Jcad T C 18: 4,675,952 M1238T probably damaging Het
Kank1 T C 19: 25,410,457 L498S probably damaging Het
Krt10 G A 11: 99,387,107 T338I possibly damaging Het
Krt13 A T 11: 100,120,051 L159Q probably benign Het
Lama1 A T 17: 67,750,553 M541L probably benign Het
Lilra6 A G 7: 3,914,858 Y96H probably damaging Het
Ltc4s A G 11: 50,237,339 probably null Het
Ly6g6e G A 17: 35,078,146 R121Q probably benign Het
Mfn1 A G 3: 32,569,515 I263V probably benign Het
Mmaa T A 8: 79,281,432 R59W probably damaging Het
Mug2 C A 6: 122,083,460 T1385K probably damaging Het
Mypn G T 10: 63,192,869 Y138* probably null Het
Nav3 A C 10: 109,863,813 S273R probably damaging Het
Ndufaf1 T C 2: 119,655,737 E298G probably damaging Het
Olfr1219 T C 2: 89,074,992 Y33C possibly damaging Het
Olfr1290 T C 2: 111,489,257 probably null Het
Olfr178 T C 16: 58,889,965 E85G probably benign Het
Olfr470 T C 7: 107,844,818 K305R probably benign Het
Olfr975 A G 9: 39,950,528 L81P possibly damaging Het
Pak1 A T 7: 97,854,479 D7V probably benign Het
Pax3 A T 1: 78,196,864 probably null Het
Plekhg1 G A 10: 3,958,048 M988I probably benign Het
Prickle1 A G 15: 93,503,637 F322S probably damaging Het
Prl8a2 A G 13: 27,348,913 E36G possibly damaging Het
Prss45 A G 9: 110,839,092 I118V possibly damaging Het
Psd4 T G 2: 24,401,241 V597G probably damaging Het
Psmb10 A G 8: 105,937,302 S108P probably benign Het
Shank3 A T 15: 89,521,210 K455* probably null Het
Spag17 T A 3: 100,027,619 W714R probably benign Het
Synrg A G 11: 84,009,224 E674G probably damaging Het
Tep1 T A 14: 50,834,023 H2055L probably benign Het
Terb1 T C 8: 104,498,595 T14A probably damaging Het
Tmub2 T A 11: 102,287,755 D161E probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Tyr T A 7: 87,429,189 I488F probably benign Het
Uba6 A G 5: 86,132,616 probably null Het
Unc13c T C 9: 73,931,547 Y674C probably damaging Het
Vmn2r105 T A 17: 20,227,835 R242S probably benign Het
Vmn2r12 A G 5: 109,086,532 Y605H probably benign Het
Wnk1 A G 6: 119,936,367 probably null Het
Zfhx4 C A 3: 5,390,405 A1153E probably benign Het
Zfp13 A C 17: 23,576,212 Y462D probably damaging Het
Zfp644 A G 5: 106,637,244 M479T possibly damaging Het
Other mutations in 6820408C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:6820408C15Rik APN 2 152442387 missense possibly damaging 0.89
IGL01986:6820408C15Rik APN 2 152441036 missense possibly damaging 0.84
IGL02153:6820408C15Rik APN 2 152441241 missense probably benign 0.06
IGL02178:6820408C15Rik APN 2 152428001 splice site probably benign
IGL03339:6820408C15Rik APN 2 152442456 missense probably damaging 1.00
R0468:6820408C15Rik UTSW 2 152441266 missense probably benign 0.01
R1624:6820408C15Rik UTSW 2 152434111 missense probably damaging 0.98
R1642:6820408C15Rik UTSW 2 152440854 missense probably damaging 1.00
R3109:6820408C15Rik UTSW 2 152442456 missense probably damaging 1.00
R3153:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3154:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3875:6820408C15Rik UTSW 2 152434080 missense probably benign
R4237:6820408C15Rik UTSW 2 152428953 missense possibly damaging 0.46
R4746:6820408C15Rik UTSW 2 152440765 missense probably benign 0.13
R4957:6820408C15Rik UTSW 2 152444093 missense probably damaging 1.00
R4959:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R4973:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R5261:6820408C15Rik UTSW 2 152440857 missense probably damaging 1.00
R5399:6820408C15Rik UTSW 2 152440868 missense probably damaging 1.00
R5971:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6138:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6223:6820408C15Rik UTSW 2 152427953 missense probably benign 0.00
R6379:6820408C15Rik UTSW 2 152427992 missense probably benign 0.01
R6642:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6815:6820408C15Rik UTSW 2 152441055 missense probably benign 0.29
R8083:6820408C15Rik UTSW 2 152441067 missense possibly damaging 0.94
U15987:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGAGGTTCACATTAGAGTTCAGG -3'
(R):5'- CTTCTACAAATGCATTGCTGGG -3'

Sequencing Primer
(F):5'- GAGTTCAGGTCACTTTAGGATACAG -3'
(R):5'- CTACAAATGCATTGCTGGGAAATG -3'
Posted On2014-11-12