Incidental Mutation 'R4237:Gpr6'
ID321179
Institutional Source Beutler Lab
Gene Symbol Gpr6
Ensembl Gene ENSMUSG00000046922
Gene NameG protein-coupled receptor 6
Synonyms
MMRRC Submission 041054-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4237 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location41069977-41072285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41070608 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 326 (N326S)
Ref Sequence ENSEMBL: ENSMUSP00000057323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061796]
Predicted Effect probably damaging
Transcript: ENSMUST00000061796
AA Change: N326S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057323
Gene: ENSMUSG00000046922
AA Change: N326S

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 37 59 N/A INTRINSIC
Pfam:7tm_1 90 330 2.5e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213704
Meta Mutation Damage Score 0.9393 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 100% (44/44)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
6820408C15Rik C T 2: 152,428,953 T32I possibly damaging Het
Abca13 A G 11: 9,434,188 K3880R probably benign Het
Ahnak C T 19: 9,001,783 L144F probably benign Het
Antxr2 A T 5: 97,938,407 I447N probably damaging Het
Cdc20 C T 4: 118,433,060 R468Q probably damaging Het
Clip2 A G 5: 134,535,197 probably benign Het
Cntnap2 A T 6: 46,530,390 probably benign Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dicer1 A G 12: 104,729,228 V148A possibly damaging Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Galnt11 G A 5: 25,265,260 R569Q probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
L3mbtl3 G A 10: 26,340,948 A181V unknown Het
Lrrc37a G A 11: 103,502,289 T770I probably damaging Het
Olfr1120 T C 2: 87,358,253 S270P probably damaging Het
Olfr2 T C 7: 107,001,329 N177S probably damaging Het
Olfr715 A G 7: 107,129,037 S119P probably damaging Het
Olfr850 C T 9: 19,477,597 V215I probably benign Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Ppp1r13b T C 12: 111,838,736 T181A probably benign Het
Prc1 G A 7: 80,311,216 probably benign Het
Proca1 A G 11: 78,204,926 N128S probably benign Het
Psmd8 G A 7: 29,177,121 P155L probably damaging Het
Rad54l A G 4: 116,099,449 V500A probably damaging Het
Scamp3 G A 3: 89,181,927 probably null Het
Serpinb10 C T 1: 107,538,449 T55M probably benign Het
Sipa1l2 T C 8: 125,491,656 E314G probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Tdrd9 C T 12: 112,067,625 R1334* probably null Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trim28 T A 7: 13,027,911 H268Q possibly damaging Het
Vmn2r76 T A 7: 86,230,532 I187L probably benign Het
Wdr95 A T 5: 149,563,337 R160* probably null Het
Wnt5a T C 14: 28,522,866 C357R probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Zfp184 G A 13: 21,958,778 R218H probably damaging Het
Other mutations in Gpr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Gpr6 APN 10 41070816 missense probably damaging 0.99
IGL01010:Gpr6 APN 10 41071151 missense probably benign
IGL01098:Gpr6 APN 10 41070743 missense probably damaging 1.00
IGL01323:Gpr6 APN 10 41071559 missense possibly damaging 0.96
R1153:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1154:Gpr6 UTSW 10 41070837 missense probably damaging 1.00
R1622:Gpr6 UTSW 10 41071292 missense probably damaging 1.00
R1628:Gpr6 UTSW 10 41071548 missense possibly damaging 0.96
R1638:Gpr6 UTSW 10 41070534 missense probably benign 0.02
R1935:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R1936:Gpr6 UTSW 10 41071481 missense probably benign 0.02
R2108:Gpr6 UTSW 10 41070653 missense possibly damaging 0.79
R2129:Gpr6 UTSW 10 41071172 missense possibly damaging 0.50
R4024:Gpr6 UTSW 10 41071268 missense probably damaging 1.00
R4418:Gpr6 UTSW 10 41070608 missense probably damaging 1.00
R4703:Gpr6 UTSW 10 41071041 missense probably damaging 1.00
R4814:Gpr6 UTSW 10 41071262 missense possibly damaging 0.94
R6821:Gpr6 UTSW 10 41071008 missense probably benign 0.04
R7190:Gpr6 UTSW 10 41070960 missense probably damaging 1.00
R7573:Gpr6 UTSW 10 41070872 missense probably damaging 0.99
R7574:Gpr6 UTSW 10 41070656 missense possibly damaging 0.47
R7611:Gpr6 UTSW 10 41070879 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAGTTCATCAGCAGGCAC -3'
(R):5'- ATCGCTTTGCAACAGCATTG -3'

Sequencing Primer
(F):5'- GTTCATCAGCAGGCACCTTGAC -3'
(R):5'- AGCATTGCCTAGCACCG -3'
Posted On2015-06-12