Incidental Mutation 'R4385:Scp2'
ID326152
Institutional Source Beutler Lab
Gene Symbol Scp2
Ensembl Gene ENSMUSG00000028603
Gene Namesterol carrier protein 2, liver
SynonymsNSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location108043839-108144998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108071350 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 381 (V381D)
Ref Sequence ENSEMBL: ENSMUSP00000030340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000044248] [ENSMUST00000106701]
Predicted Effect probably damaging
Transcript: ENSMUST00000030340
AA Change: V381D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: V381D

DomainStartEndE-ValueType
Pfam:Thiolase_N 14 240 9.6e-25 PFAM
Pfam:Thiolase_C 277 402 2.9e-15 PFAM
Pfam:SCP2 437 539 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106701
SMART Domains Protein: ENSMUSP00000102312
Gene: ENSMUSG00000028603

DomainStartEndE-ValueType
Pfam:Alkyl_sulf_C 18 140 5e-11 PFAM
Pfam:SCP2 33 135 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135379
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Scp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Scp2 APN 4 108074442 intron probably null
IGL02190:Scp2 APN 4 108087128 missense probably benign 0.22
IGL02615:Scp2 APN 4 108107631 missense probably benign 0.40
IGL03006:Scp2 APN 4 108091280 missense probably benign 0.00
IGL03107:Scp2 APN 4 108098115 missense probably benign 0.00
IGL03124:Scp2 APN 4 108063906 missense probably damaging 1.00
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R1507:Scp2 UTSW 4 108087012 frame shift probably null
R1861:Scp2 UTSW 4 108091321 missense probably damaging 1.00
R2151:Scp2 UTSW 4 108063944 missense probably benign
R3013:Scp2 UTSW 4 108071357 missense probably damaging 1.00
R4127:Scp2 UTSW 4 108063984 missense probably benign 0.00
R4271:Scp2 UTSW 4 108085211 missense probably damaging 1.00
R5046:Scp2 UTSW 4 108071291 missense probably benign 0.07
R5345:Scp2 UTSW 4 108055579 splice site probably null
R5401:Scp2 UTSW 4 108144779 critical splice donor site probably null
R6367:Scp2 UTSW 4 108112250 missense probably damaging 1.00
R6415:Scp2 UTSW 4 108105140 missense probably benign 0.22
R6681:Scp2 UTSW 4 108091316 missense probably damaging 1.00
R6910:Scp2 UTSW 4 108105086 missense probably damaging 1.00
R6974:Scp2 UTSW 4 108071278 start codon destroyed probably null 0.01
R7206:Scp2 UTSW 4 108074441 missense probably benign 0.00
R7342:Scp2 UTSW 4 108091321 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTCCTAAGGTTGTCTCGGC -3'
(R):5'- CTGTGAATCTTGGGCTTTAAGC -3'

Sequencing Primer
(F):5'- CCTAAGGTTGTCTCGGCTTAAAAAC -3'
(R):5'- GCTTTAAGCTCTGCAGGCG -3'
Posted On2015-07-06