Incidental Mutation 'R7342:Scp2'
ID569918
Institutional Source Beutler Lab
Gene Symbol Scp2
Ensembl Gene ENSMUSG00000028603
Gene Namesterol carrier protein 2, liver
SynonymsNSL-TP, nonspecific lipid transfer protein, SCPx, SCP-2, ns-LTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7342 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location108043839-108144998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108091321 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 197 (Y197F)
Ref Sequence ENSEMBL: ENSMUSP00000030340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030340] [ENSMUST00000044248] [ENSMUST00000149106]
Predicted Effect probably benign
Transcript: ENSMUST00000030340
AA Change: Y197F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000030340
Gene: ENSMUSG00000028603
AA Change: Y197F

DomainStartEndE-ValueType
Pfam:Thiolase_N 14 240 9.6e-25 PFAM
Pfam:Thiolase_C 277 402 2.9e-15 PFAM
Pfam:SCP2 437 539 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044248
SMART Domains Protein: ENSMUSP00000048962
Gene: ENSMUSG00000028600

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 40 49 N/A INTRINSIC
LRRNT 68 101 4.34e-5 SMART
LRR_TYP 120 145 2.05e-2 SMART
LRR 146 169 1.19e1 SMART
LRR 192 216 2.84e1 SMART
LRR 239 261 6.22e0 SMART
LRR 262 287 3.47e0 SMART
LRR_TYP 288 311 7.9e-4 SMART
LRR 333 358 1.26e1 SMART
LRR 359 382 2.82e0 SMART
LRR 407 429 1.53e2 SMART
LRR_TYP 430 453 7.37e-4 SMART
LRR 475 500 1.66e1 SMART
LRR 501 522 1.29e1 SMART
LRR_TYP 523 545 7.67e-2 SMART
low complexity region 594 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149106
AA Change: Y153F

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121673
Gene: ENSMUSG00000028603
AA Change: Y153F

DomainStartEndE-ValueType
SCOP:d1qfla1 14 202 2e-18 SMART
Meta Mutation Damage Score 0.1703 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins: sterol carrier protein X (SCPx) and sterol carrier protein 2 (SCP2), as a result of transcription initiation from 2 independently regulated promoters. The transcript initiated from the proximal promoter encodes the longer SCPx protein, and the transcript initiated from the distal promoter encodes the shorter SCP2 protein, with the 2 proteins sharing a common C-terminus. Evidence suggests that the SCPx protein is a peroxisome-associated thiolase that is involved in the oxidation of branched chain fatty acids, while the SCP2 protein is thought to be an intracellular lipid transfer protein. This gene is highly expressed in organs involved in lipid metabolism, and may play a role in Zellweger syndrome, in which cells are deficient in peroxisomes and have impaired bile acid synthesis. Alternative splicing of this gene produces multiple transcript variants, some encoding different isoforms.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene exhibit altered lipid levels and both males and females are sensitive to phytol-rich diets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T G 11: 101,417,192 T28P probably benign Het
Abcc1 C A 16: 14,465,169 R1170S probably damaging Het
Adam8 T C 7: 139,986,391 N568S probably benign Het
Arhgap17 T C 7: 123,327,244 R65G probably damaging Het
Arid4b A C 13: 14,136,219 I136L probably benign Het
Ash1l G T 3: 88,965,997 G29V possibly damaging Het
Atp6v0a2 A G 5: 124,646,736 T320A probably damaging Het
B4gat1 G A 19: 5,039,658 V228M probably benign Het
Calcr T A 6: 3,691,536 H450L probably benign Het
Cand1 A T 10: 119,211,787 N599K possibly damaging Het
Cel A T 2: 28,560,637 Y125* probably null Het
Cfi T A 3: 129,875,132 N602K probably damaging Het
Clstn1 G A 4: 149,629,430 A190T probably damaging Het
Cmklr1 C T 5: 113,614,293 V216M probably benign Het
Cntnap5a A G 1: 116,060,122 T128A probably benign Het
Creld2 A G 15: 88,826,407 T342A probably benign Het
Ctbp2 T C 7: 133,014,312 E298G probably damaging Het
Ctsh A T 9: 90,074,987 E307V probably benign Het
Cxcl10 T A 5: 92,348,170 D36V probably benign Het
Dgkb A G 12: 38,100,433 T73A probably benign Het
Dnah3 T G 7: 120,029,985 E1449A probably damaging Het
Dpp6 T C 5: 27,714,554 M683T probably benign Het
Foxn4 C A 5: 114,258,699 W241L probably damaging Het
Gif A T 19: 11,763,223 H407L probably benign Het
Gosr1 T C 11: 76,730,207 I219V probably benign Het
Gtf2f2 T C 14: 75,906,877 D179G probably damaging Het
Ighg2b A G 12: 113,306,430 Y323H Het
Itpr2 A T 6: 146,327,187 H1303Q probably damaging Het
Kif1b A C 4: 149,214,090 Y1040D possibly damaging Het
Lbr C T 1: 181,825,621 probably null Het
Lrp2 A G 2: 69,479,290 V2755A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Lrrcc1 T A 3: 14,554,371 C606S probably benign Het
Macf1 T C 4: 123,382,124 E6217G probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo9b T C 8: 71,355,774 V1687A probably damaging Het
Naip2 A T 13: 100,189,356 F15I probably benign Het
Neb A T 2: 52,281,667 S1605T probably damaging Het
Nuak1 T C 10: 84,374,967 E419G probably damaging Het
Olfr307 G A 7: 86,336,087 T103I probably benign Het
Olfr896-ps1 A G 9: 38,292,278 Y111C probably damaging Het
Paip2b T A 6: 83,814,826 S25C probably damaging Het
Pgbd5 G A 8: 124,433,970 R53C probably benign Het
Plin4 T C 17: 56,104,608 T808A probably benign Het
Pramef6 A T 4: 143,896,950 I218K probably benign Het
Prex2 A G 1: 11,162,325 D872G probably benign Het
Ptf1a A G 2: 19,447,166 *325W probably null Het
Ptprg T C 14: 12,237,151 V1390A possibly damaging Het
Rhpn2 A G 7: 35,334,346 T2A probably damaging Het
Rpl18a T C 8: 70,895,398 N214D unknown Het
Sftpb G A 6: 72,309,875 R254H probably benign Het
Slc17a9 T C 2: 180,736,762 L246P probably damaging Het
Slc38a9 G T 13: 112,669,591 probably benign Het
Slc4a1ap C T 5: 31,536,290 L523F possibly damaging Het
Spats2l C A 1: 57,885,947 T168K possibly damaging Het
Sstr1 A G 12: 58,213,670 S360G possibly damaging Het
Taf1b A T 12: 24,558,344 K581* probably null Het
Tfip11 T A 5: 112,327,972 M1K probably null Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Ttc23l G A 15: 10,551,497 H48Y probably benign Het
Uggt2 T A 14: 118,994,972 H1489L possibly damaging Het
Unc13b T C 4: 43,258,703 L1346P probably damaging Het
Vmac T C 17: 56,715,644 E122G probably benign Het
Vmn2r125 T C 4: 156,350,843 V172A probably damaging Het
Zfp54 A G 17: 21,427,752 probably benign Het
Other mutations in Scp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Scp2 APN 4 108074442 intron probably null
IGL02190:Scp2 APN 4 108087128 missense probably benign 0.22
IGL02615:Scp2 APN 4 108107631 missense probably benign 0.40
IGL03006:Scp2 APN 4 108091280 missense probably benign 0.00
IGL03107:Scp2 APN 4 108098115 missense probably benign 0.00
IGL03124:Scp2 APN 4 108063906 missense probably damaging 1.00
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0030:Scp2 UTSW 4 108107690 critical splice acceptor site probably null
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R0240:Scp2 UTSW 4 108098078 missense probably benign 0.01
R1507:Scp2 UTSW 4 108087012 frame shift probably null
R1861:Scp2 UTSW 4 108091321 missense probably damaging 1.00
R2151:Scp2 UTSW 4 108063944 missense probably benign
R3013:Scp2 UTSW 4 108071357 missense probably damaging 1.00
R4127:Scp2 UTSW 4 108063984 missense probably benign 0.00
R4271:Scp2 UTSW 4 108085211 missense probably damaging 1.00
R4385:Scp2 UTSW 4 108071350 missense probably damaging 1.00
R5046:Scp2 UTSW 4 108071291 missense probably benign 0.07
R5345:Scp2 UTSW 4 108055579 splice site probably null
R5401:Scp2 UTSW 4 108144779 critical splice donor site probably null
R6367:Scp2 UTSW 4 108112250 missense probably damaging 1.00
R6415:Scp2 UTSW 4 108105140 missense probably benign 0.22
R6681:Scp2 UTSW 4 108091316 missense probably damaging 1.00
R6910:Scp2 UTSW 4 108105086 missense probably damaging 1.00
R6974:Scp2 UTSW 4 108071278 start codon destroyed probably null 0.01
R7206:Scp2 UTSW 4 108074441 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTCTATAGAAGCTGCAGAGAC -3'
(R):5'- GAGCATGCAAGGTCACAGTTC -3'

Sequencing Primer
(F):5'- CTGCAGAGACATCATAAAGGTTAGCC -3'
(R):5'- ACTTTGTAGACCAGGCTG -3'
Posted On2019-09-13