Incidental Mutation 'R4404:Il22ra1'
ID326753
Institutional Source Beutler Lab
Gene Symbol Il22ra1
Ensembl Gene ENSMUSG00000037157
Gene Nameinterleukin 22 receptor, alpha 1
SynonymsIl22r
MMRRC Submission 041133-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4404 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135728172-135752140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135737431 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 149 (E149D)
Ref Sequence ENSEMBL: ENSMUSP00000099605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102546
AA Change: E149D

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099605
Gene: ENSMUSG00000037157
AA Change: E149D

DomainStartEndE-ValueType
Pfam:Tissue_fac 4 106 1.1e-29 PFAM
Pfam:Interfer-bind 119 214 7.5e-7 PFAM
transmembrane domain 227 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
C87414 T A 5: 93,637,713 H236L possibly damaging Het
Ccdc188 A G 16: 18,218,420 Q153R probably damaging Het
Dopey1 T A 9: 86,522,813 L1721* probably null Het
Fer A T 17: 63,941,289 probably null Het
Fuk T A 8: 110,890,301 T406S probably benign Het
Gprc6a T C 10: 51,628,543 I68M probably benign Het
Gria4 A T 9: 4,464,489 probably null Het
Gtf3c4 T C 2: 28,826,749 D813G probably damaging Het
Hars2 G T 18: 36,785,936 C83F probably damaging Het
Htr6 A G 4: 139,062,202 S251P probably benign Het
Igsf10 T C 3: 59,329,551 T1070A probably benign Het
Lama3 G A 18: 12,582,531 M1681I probably benign Het
Loxhd1 G A 18: 77,431,132 G1878D probably damaging Het
Mcc G A 18: 44,759,298 T83M probably benign Het
Nol11 A T 11: 107,173,725 C468S probably damaging Het
Nomo1 A G 7: 46,056,668 N482S probably benign Het
Npy5r C T 8: 66,681,992 V50I probably benign Het
Olfr935 T C 9: 38,994,569 I289V possibly damaging Het
Pam T C 1: 97,854,721 probably benign Het
Pank4 C T 4: 154,980,156 T724I probably benign Het
Pifo G A 3: 106,001,368 P7L probably benign Het
Sertm1 C T 3: 54,899,325 C93Y probably damaging Het
Slc22a2 A G 17: 12,614,764 T444A probably damaging Het
Trpm7 C A 2: 126,833,715 L489F probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp25 A C 16: 77,115,453 K1020T probably damaging Het
Vmn2r76 T C 7: 86,228,303 T511A probably benign Het
Zdhhc15 G A X: 104,560,688 R322* probably null Het
Other mutations in Il22ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Il22ra1 APN 4 135751084 missense possibly damaging 0.84
IGL01480:Il22ra1 APN 4 135744801 missense probably benign 0.03
IGL02533:Il22ra1 APN 4 135744723 missense possibly damaging 0.94
R0137:Il22ra1 UTSW 4 135751006 missense probably benign 0.00
R0196:Il22ra1 UTSW 4 135734245 missense possibly damaging 0.67
R1647:Il22ra1 UTSW 4 135750460 missense probably damaging 0.98
R1800:Il22ra1 UTSW 4 135748160 missense probably benign 0.10
R1901:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1902:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1903:Il22ra1 UTSW 4 135750908 missense probably damaging 1.00
R1906:Il22ra1 UTSW 4 135751233 missense probably damaging 1.00
R4278:Il22ra1 UTSW 4 135750713 missense possibly damaging 0.93
R5001:Il22ra1 UTSW 4 135733104 missense probably damaging 1.00
R6666:Il22ra1 UTSW 4 135750461 missense probably damaging 0.98
R7054:Il22ra1 UTSW 4 135751162 missense probably benign 0.00
R7615:Il22ra1 UTSW 4 135737459 missense probably benign 0.16
R7644:Il22ra1 UTSW 4 135733035 missense probably damaging 1.00
R7754:Il22ra1 UTSW 4 135734250 missense probably benign 0.01
R7808:Il22ra1 UTSW 4 135750796 missense possibly damaging 0.93
R8024:Il22ra1 UTSW 4 135734278 missense probably benign 0.43
Z1177:Il22ra1 UTSW 4 135737406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCTTGGACACCTGCCAC -3'
(R):5'- AGCCCTGCAAGGATATTTTCTG -3'

Sequencing Primer
(F):5'- ACCCAAAGGTCTCTTTTCACATG -3'
(R):5'- CCCTGCAAGGATATTTTCTGGGAAG -3'
Posted On2015-07-07