Incidental Mutation 'R0099:Rgs17'
ID33155
Institutional Source Beutler Lab
Gene Symbol Rgs17
Ensembl Gene ENSMUSG00000019775
Gene Nameregulator of G-protein signaling 17
Synonyms6430507P11Rik, RGSZ2
MMRRC Submission 038385-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R0099 (G1)
Quality Score165
Status Validated (trace)
Chromosome10
Chromosomal Location5825663-5922400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5842583 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 74 (R74S)
Ref Sequence ENSEMBL: ENSMUSP00000065825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019909] [ENSMUST00000064225] [ENSMUST00000117676] [ENSMUST00000131996]
Predicted Effect probably benign
Transcript: ENSMUST00000019909
AA Change: R54S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000019909
Gene: ENSMUSG00000019775
AA Change: R54S

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 163 7.96e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064225
AA Change: R74S

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065825
Gene: ENSMUSG00000019775
AA Change: R74S

DomainStartEndE-ValueType
low complexity region 48 60 N/A INTRINSIC
RGS 104 220 4.54e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117676
AA Change: R54S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113519
Gene: ENSMUSG00000019775
AA Change: R54S

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 200 4.54e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131996
AA Change: R54S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116291
Gene: ENSMUSG00000019775
AA Change: R54S

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
RGS 84 200 4.54e-49 SMART
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein contains a conserved, 120 amino acid motif called the RGS domain and a cysteine-rich region. The protein attenuates the signaling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018M24Rik C T 14: 50,896,722 probably benign Het
Acad10 A C 5: 121,621,290 D1043E probably damaging Het
Adamtsl4 C T 3: 95,684,139 G173R probably benign Het
Astn1 G T 1: 158,502,151 S192I probably damaging Het
Atg2a T A 19: 6,252,789 V1010E probably damaging Het
C130079G13Rik A C 3: 59,936,435 K183N probably benign Het
Col11a2 A G 17: 34,049,674 E311G probably damaging Het
Col4a3 A C 1: 82,717,993 E1638A probably benign Het
Cstf2t A G 19: 31,083,831 R256G probably benign Het
Cyp4a12a T C 4: 115,326,672 L225P probably damaging Het
Diexf A G 1: 193,128,470 L75P probably damaging Het
Dnah5 G A 15: 28,239,934 R479H probably damaging Het
Dsg3 A G 18: 20,540,022 I917V probably benign Het
Fam76a G T 4: 132,910,787 probably benign Het
Fras1 T A 5: 96,614,917 probably null Het
Gli1 A G 10: 127,336,006 V293A probably damaging Het
Gm10782 T A 13: 56,363,143 noncoding transcript Het
Greb1l A G 18: 10,509,158 E490G probably damaging Het
Hydin G A 8: 110,589,561 G4362R probably damaging Het
Ica1 A T 6: 8,749,778 probably benign Het
Ikzf4 T A 10: 128,634,197 I485F probably damaging Het
Irf5 A G 6: 29,533,967 T34A probably damaging Het
Krt81 A T 15: 101,463,521 C59* probably null Het
Kynu T A 2: 43,629,053 probably null Het
Ly6g6c T C 17: 35,068,915 V61A probably damaging Het
Manea A C 4: 26,328,104 I312M probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Mthfs A T 9: 89,226,163 probably benign Het
Myh4 A G 11: 67,259,347 T1877A probably benign Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Nepn A G 10: 52,401,085 S306G probably damaging Het
Nol8 T C 13: 49,672,689 V995A probably benign Het
Olfr1453 A G 19: 13,027,801 F176S probably damaging Het
Olfr1458 T A 19: 13,103,140 T49S probably benign Het
Olfr160 A T 9: 37,711,454 V275E probably damaging Het
Olfr967 A G 9: 39,750,661 I92V possibly damaging Het
Pde1a T A 2: 79,868,313 probably null Het
Phf14 A G 6: 11,987,697 probably benign Het
Plekhh2 C T 17: 84,591,672 Q1026* probably null Het
Polr2b T A 5: 77,320,950 probably benign Het
Ppp1r36 G T 12: 76,436,282 probably null Het
Prdm14 A T 1: 13,118,945 C392S probably damaging Het
Rabgap1l A G 1: 160,682,116 S436P possibly damaging Het
Rfc2 A T 5: 134,595,281 probably null Het
Rfx4 A T 10: 84,894,304 M437L probably benign Het
Rnf139 C A 15: 58,899,415 L430I probably damaging Het
Sgsm1 C A 5: 113,274,360 probably benign Het
Skint6 T A 4: 112,811,501 T1126S possibly damaging Het
Slc15a2 T C 16: 36,753,036 E602G probably damaging Het
Stpg2 T C 3: 139,243,193 probably benign Het
Sycp2l T C 13: 41,129,525 probably benign Het
Tlr11 A T 14: 50,360,818 N87I probably benign Het
Tril A G 6: 53,818,363 F625L probably damaging Het
Ube3c T A 5: 29,607,064 V434E probably damaging Het
Usp34 G A 11: 23,363,111 G533R probably damaging Het
Zfp93 G T 7: 24,275,475 R295L probably benign Het
Other mutations in Rgs17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Rgs17 APN 10 5862624 missense possibly damaging 0.80
R1564:Rgs17 UTSW 10 5842567 nonsense probably null
R2424:Rgs17 UTSW 10 5833111 missense probably damaging 1.00
R2424:Rgs17 UTSW 10 5842560 missense probably benign 0.33
R4519:Rgs17 UTSW 10 5918192 missense probably benign 0.00
R4585:Rgs17 UTSW 10 5842596 missense probably benign 0.00
R5738:Rgs17 UTSW 10 5833140 missense probably damaging 1.00
R6744:Rgs17 UTSW 10 5842567 missense possibly damaging 0.55
R7625:Rgs17 UTSW 10 5841488 missense probably benign
R7816:Rgs17 UTSW 10 5841501 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCACAGAACCGTTTGCGAGAG -3'
(R):5'- TGGAGTCAGAGTAGACAGCGATATCC -3'

Sequencing Primer
(F):5'- GGCCCATAGAGATGATGCTTG -3'
(R):5'- TGGTATAGACTTACTAACTCTCACTC -3'
Posted On2013-05-09