Incidental Mutation 'R4636:Cyp2d34'
ID350745
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4636 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 82620728 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 44 (P44A)
Ref Sequence ENSEMBL: ENSMUSP00000155117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably damaging
Transcript: ENSMUST00000109515
AA Change: P44A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559
AA Change: P44A

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229833
AA Change: P44A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231012
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcs T C 1: 172,894,422 E119G probably damaging Het
Arhgef5 A G 6: 43,274,942 T876A probably benign Het
Arih2 A T 9: 108,613,814 C227S probably damaging Het
Bsn A T 9: 108,115,424 L1043Q probably damaging Het
Ddx59 T A 1: 136,432,563 N438K probably damaging Het
Esr2 A G 12: 76,123,324 M447T possibly damaging Het
Fam131b A G 6: 42,320,980 S92P probably damaging Het
Galnt9 A G 5: 110,615,499 M457V probably damaging Het
Gorasp2 T A 2: 70,679,492 Y166N probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Mrpl1 G T 5: 96,210,175 V5L probably benign Het
Nifk T A 1: 118,329,487 Y117N possibly damaging Het
Notch2 A G 3: 98,146,104 K2028E probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Prpf3 A G 3: 95,834,170 F558S probably damaging Het
Rabgap1l T C 1: 160,342,090 probably null Het
Rasa2 C T 9: 96,544,337 D819N probably benign Het
Rbl1 T A 2: 157,167,420 T732S possibly damaging Het
Slc14a2 A G 18: 78,195,792 V204A possibly damaging Het
Ttn A C 2: 76,813,593 L13097R probably damaging Het
Wdpcp A G 11: 21,711,568 E280G probably benign Het
Znhit6 A G 3: 145,600,578 silent Het
Znhit6 G T 3: 145,600,579 V280L probably null Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2432:Cyp2d34 UTSW 15 82619011 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3834:Cyp2d34 UTSW 15 82616746 critical splice donor site probably null
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4181:Cyp2d34 UTSW 15 82617285 splice site probably null
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5402:Cyp2d34 UTSW 15 82619086 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7391:Cyp2d34 UTSW 15 82618386 missense probably benign 0.14
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTAGAAAGTCCCAGTGGATGC -3'
(R):5'- GCTTGGTGCTTCCTGATCCTAG -3'

Sequencing Primer
(F):5'- CCCCTACTATGTGCTGAT -3'
(R):5'- GCTTCCTGATCCTAGGTGTTG -3'
Posted On2015-10-08