Incidental Mutation 'R4636:Rasa2'
ID350737
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R4636 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96544337 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 819 (D819N)
Ref Sequence ENSEMBL: ENSMUSP00000034984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect probably benign
Transcript: ENSMUST00000034984
AA Change: D819N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413
AA Change: D819N

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128346
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188853
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcs T C 1: 172,894,422 E119G probably damaging Het
Arhgef5 A G 6: 43,274,942 T876A probably benign Het
Arih2 A T 9: 108,613,814 C227S probably damaging Het
Bsn A T 9: 108,115,424 L1043Q probably damaging Het
Cyp2d34 G C 15: 82,620,728 P44A probably damaging Het
Ddx59 T A 1: 136,432,563 N438K probably damaging Het
Esr2 A G 12: 76,123,324 M447T possibly damaging Het
Fam131b A G 6: 42,320,980 S92P probably damaging Het
Galnt9 A G 5: 110,615,499 M457V probably damaging Het
Gorasp2 T A 2: 70,679,492 Y166N probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Mrpl1 G T 5: 96,210,175 V5L probably benign Het
Nifk T A 1: 118,329,487 Y117N possibly damaging Het
Notch2 A G 3: 98,146,104 K2028E probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Prpf3 A G 3: 95,834,170 F558S probably damaging Het
Rabgap1l T C 1: 160,342,090 probably null Het
Rbl1 T A 2: 157,167,420 T732S possibly damaging Het
Slc14a2 A G 18: 78,195,792 V204A possibly damaging Het
Ttn A C 2: 76,813,593 L13097R probably damaging Het
Wdpcp A G 11: 21,711,568 E280G probably benign Het
Znhit6 A G 3: 145,600,578 silent Het
Znhit6 G T 3: 145,600,579 V280L probably null Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0295:Rasa2 UTSW 9 96545810 splice site probably null
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R0931:Rasa2 UTSW 9 96552404 missense possibly damaging 0.88
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R3055:Rasa2 UTSW 9 96611473 missense possibly damaging 0.77
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7421:Rasa2 UTSW 9 96611447 missense unknown
R7490:Rasa2 UTSW 9 96566122 missense possibly damaging 0.48
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7821:Rasa2 UTSW 9 96580484 splice site probably null
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGCACTGACAGAAAGGATG -3'
(R):5'- CCTGTGCTCTTGTCAAAGAAAC -3'

Sequencing Primer
(F):5'- AAAGGATGGCTGGCCTGC -3'
(R):5'- AATTACACTACAGATTACACTTGTGG -3'
Posted On2015-10-08