Incidental Mutation 'R4685:Kyat1'
ID353585
Institutional Source Beutler Lab
Gene Symbol Kyat1
Ensembl Gene ENSMUSG00000039648
Gene Namekynurenine aminotransferase 1
SynonymsKat1, 2010009K05Rik, Ccbl1, KATI, cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase)
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30185124-30205847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30188265 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 101 (Y101H)
Ref Sequence ENSEMBL: ENSMUSP00000109293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044038] [ENSMUST00000113659] [ENSMUST00000113660] [ENSMUST00000113661] [ENSMUST00000113662] [ENSMUST00000113663]
Predicted Effect probably damaging
Transcript: ENSMUST00000044038
AA Change: Y101H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038612
Gene: ENSMUSG00000039648
AA Change: Y101H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113659
SMART Domains Protein: ENSMUSP00000109289
Gene: ENSMUSG00000039648

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 53 365 1.5e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113660
AA Change: Y101H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109290
Gene: ENSMUSG00000039648
AA Change: Y101H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 145 1.7e-12 PFAM
Pfam:Aminotran_1_2 146 372 1e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113661
AA Change: Y101H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109291
Gene: ENSMUSG00000039648
AA Change: Y101H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113662
AA Change: Y101H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109292
Gene: ENSMUSG00000039648
AA Change: Y101H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113663
AA Change: Y101H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109293
Gene: ENSMUSG00000039648
AA Change: Y101H

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 28 415 1.1e-56 PFAM
Pfam:DegT_DnrJ_EryC1 80 214 3.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149522
Meta Mutation Damage Score 0.7077 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that is responsible for the metabolism of cysteine conjugates of certain halogenated alkenes and alkanes. This metabolism can form reactive metabolites leading to nephrotoxicity and neurotoxicity. Increased levels of this enzyme have been linked to schizophrenia. Multiple transcript variants that encode different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Kyat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Kyat1 APN 2 30185553 missense probably benign 0.00
IGL02216:Kyat1 APN 2 30187252 missense probably benign 0.44
IGL02864:Kyat1 APN 2 30192077 splice site probably benign
IGL02975:Kyat1 APN 2 30186675 missense probably damaging 0.99
R0193:Kyat1 UTSW 2 30187186 critical splice donor site probably null
R0230:Kyat1 UTSW 2 30194075 missense probably benign
R0539:Kyat1 UTSW 2 30188217 missense probably damaging 1.00
R2483:Kyat1 UTSW 2 30186698 missense possibly damaging 0.71
R3935:Kyat1 UTSW 2 30185749 missense probably damaging 1.00
R4651:Kyat1 UTSW 2 30194064 missense probably benign 0.00
R5031:Kyat1 UTSW 2 30188090 missense probably damaging 1.00
R5699:Kyat1 UTSW 2 30186650 missense probably benign 0.01
R5722:Kyat1 UTSW 2 30188111 missense probably damaging 1.00
R7299:Kyat1 UTSW 2 30191995 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATTCCTTACCAGCCTCAGG -3'
(R):5'- AAGCTGACTTCTGCCTGAGTC -3'

Sequencing Primer
(F):5'- CCAGCCATCATTGTCATGGG -3'
(R):5'- ACTTCTGCCTGAGTCTAGCTGAG -3'
Posted On2015-10-21