Incidental Mutation 'R4992:Tmem55b'
ID386294
Institutional Source Beutler Lab
Gene Symbol Tmem55b
Ensembl Gene ENSMUSG00000035953
Gene Nametransmembrane protein 55b
Synonyms
MMRRC Submission 042586-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R4992 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50926068-50930856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50929233 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 179 (V179A)
Ref Sequence ENSEMBL: ENSMUSP00000124782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006452] [ENSMUST00000049312] [ENSMUST00000049411] [ENSMUST00000128395] [ENSMUST00000136753] [ENSMUST00000154288] [ENSMUST00000159292] [ENSMUST00000160375] [ENSMUST00000160393] [ENSMUST00000160538] [ENSMUST00000160835] [ENSMUST00000160890] [ENSMUST00000161166] [ENSMUST00000162177] [ENSMUST00000162957] [ENSMUST00000226871]
Predicted Effect probably benign
Transcript: ENSMUST00000006452
SMART Domains Protein: ENSMUSP00000006452
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 186 1.1e-55 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000049312
AA Change: V172A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038276
Gene: ENSMUSG00000035953
AA Change: V172A

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 270 9.8e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049411
SMART Domains Protein: ENSMUSP00000042602
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 308 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128395
SMART Domains Protein: ENSMUSP00000116319
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 9 35 N/A INTRINSIC
Pfam:Exo_endo_phos 59 280 2.3e-24 PFAM
Pfam:Exo_endo_phos_2 138 284 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136753
SMART Domains Protein: ENSMUSP00000123148
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 177 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154288
SMART Domains Protein: ENSMUSP00000122343
Gene: ENSMUSG00000035960

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
Pfam:Exo_endo_phos 64 214 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159047
Predicted Effect probably benign
Transcript: ENSMUST00000159292
SMART Domains Protein: ENSMUSP00000124039
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159745
Predicted Effect probably benign
Transcript: ENSMUST00000160375
SMART Domains Protein: ENSMUSP00000124099
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 156 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160393
SMART Domains Protein: ENSMUSP00000125155
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 301 3.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160464
Predicted Effect probably damaging
Transcript: ENSMUST00000160538
AA Change: V179A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124259
Gene: ENSMUSG00000035953
AA Change: V179A

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 197 1.9e-82 PFAM
low complexity region 221 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160835
AA Change: V179A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124782
Gene: ENSMUSG00000035953
AA Change: V179A

DomainStartEndE-ValueType
Pfam:Tmemb_55A 4 277 2.8e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160890
SMART Domains Protein: ENSMUSP00000124659
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 23 79 1.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161166
SMART Domains Protein: ENSMUSP00000125414
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 168 3.6e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161669
Predicted Effect probably benign
Transcript: ENSMUST00000162177
SMART Domains Protein: ENSMUSP00000124016
Gene: ENSMUSG00000006289

DomainStartEndE-ValueType
Pfam:Peptidase_M22 1 220 1.1e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162935
Predicted Effect probably benign
Transcript: ENSMUST00000162957
SMART Domains Protein: ENSMUSP00000123697
Gene: ENSMUSG00000035953

DomainStartEndE-ValueType
Pfam:Tmemb_55A 1 174 2.9e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163088
Predicted Effect probably benign
Transcript: ENSMUST00000226871
Meta Mutation Damage Score 0.4747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 98% (84/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TMEM55B catalyzes the degradation of phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2) by removing the 4-phosphate (Ungewickell et al., 2005 [PubMed 16365287]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,064,002 R700Q possibly damaging Het
4930444P10Rik T A 1: 16,080,877 E27V probably damaging Het
Acsm4 T A 7: 119,711,417 I509N probably benign Het
Asb18 T C 1: 89,952,863 M143V probably benign Het
Birc6 A G 17: 74,689,256 D4475G probably benign Het
Bsn A T 9: 108,115,548 S1002T probably damaging Het
Bub3 T C 7: 131,560,806 S33P probably damaging Het
Ccna1 T A 3: 55,049,890 R35S probably damaging Het
Cdc23 T A 18: 34,646,919 M119L probably benign Het
Ces1a A G 8: 93,045,022 V49A probably benign Het
Chil1 A T 1: 134,188,626 E282D probably benign Het
Crocc G A 4: 141,046,666 A220V probably damaging Het
Cstf1 A G 2: 172,377,800 Y277C probably damaging Het
D930020B18Rik C G 10: 121,654,761 P89A probably damaging Het
D930020B18Rik C T 10: 121,654,762 P89L probably damaging Het
Dennd5a A G 7: 109,894,712 S1262P probably damaging Het
Dnajb5 G A 4: 42,953,386 probably null Het
E330034G19Rik A G 14: 24,306,996 K200R unknown Het
Ect2l A G 10: 18,172,729 F156S probably benign Het
Egf T C 3: 129,711,530 probably null Het
Elmo1 T C 13: 20,342,519 F413S probably damaging Het
Elmo3 T A 8: 105,309,501 Y607* probably null Het
Eno3 A G 11: 70,658,647 D98G probably damaging Het
Ephb2 A G 4: 136,660,839 V651A probably damaging Het
Fbp1 C T 13: 62,865,074 V102I probably benign Het
Gcn1l1 T C 5: 115,599,166 V1321A probably benign Het
Gimd1 A T 3: 132,634,957 Y78F probably benign Het
Glmn T G 5: 107,557,301 D483A probably damaging Het
Gsr C T 8: 33,693,913 T401I probably damaging Het
Htr3b G A 9: 48,959,218 H62Y possibly damaging Het
Ifna6 T C 4: 88,827,540 V42A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Inpp4b A T 8: 82,033,208 R627S probably damaging Het
Kif13a C T 13: 46,777,163 V142M probably damaging Het
Lims1 A C 10: 58,410,241 probably benign Het
Ltn1 T C 16: 87,405,587 T1059A possibly damaging Het
Lyst T C 13: 13,661,163 L1810P probably damaging Het
Mboat1 T G 13: 30,202,360 I119R possibly damaging Het
Mgat3 T A 15: 80,212,542 D523E probably benign Het
Mphosph9 T C 5: 124,304,190 E395G probably damaging Het
Mtcl1 G T 17: 66,342,839 P1877Q probably damaging Het
Myo6 T C 9: 80,283,510 V781A possibly damaging Het
Ncoa3 T A 2: 166,069,939 M1395K probably benign Het
Nhlrc2 T A 19: 56,570,534 D150E probably benign Het
Nlrp9a T C 7: 26,557,386 V54A probably benign Het
Olfr392 G A 11: 73,814,320 T254I probably damaging Het
Olfr411 A G 11: 74,347,197 I129T probably damaging Het
Parp14 A T 16: 35,841,142 C1479S probably benign Het
Pdcd1lg2 T C 19: 29,446,084 V176A probably damaging Het
Pibf1 T A 14: 99,150,667 N416K probably damaging Het
Polb A T 8: 22,645,071 V115E probably damaging Het
Polq T A 16: 37,061,162 N1229K possibly damaging Het
Ppp1r21 A T 17: 88,569,080 D440V probably benign Het
Ppp2ca T A 11: 52,113,206 H63Q possibly damaging Het
Prl7a1 C T 13: 27,635,686 probably null Het
Rgs1 C A 1: 144,246,322 K77N probably damaging Het
Rnf112 T A 11: 61,452,711 I100F possibly damaging Het
Rnf139 G T 15: 58,898,476 E117* probably null Het
Robo1 G A 16: 72,979,868 V743I probably damaging Het
Scarf1 T C 11: 75,522,230 L434P probably damaging Het
Scarf1 T C 11: 75,526,015 V761A probably benign Het
Sgsm1 A T 5: 113,282,620 S300T possibly damaging Het
Slc26a7 T G 4: 14,565,508 T192P probably damaging Het
Smarcc2 A G 10: 128,474,710 K403E probably damaging Het
Snai3 G A 8: 122,456,332 T158M possibly damaging Het
Spata31d1a T C 13: 59,703,151 N388D probably benign Het
Sptlc3 G A 2: 139,596,003 V406I probably benign Het
Tgds A C 14: 118,117,763 Y197D probably damaging Het
Tll1 G T 8: 64,093,944 R323S probably damaging Het
Trim14 A G 4: 46,507,110 Y369H probably damaging Het
Ube2nl C T 7: 61,549,364 noncoding transcript Het
Ube3a T A 7: 59,284,820 D560E possibly damaging Het
Vmn2r10 A G 5: 108,997,726 V505A possibly damaging Het
Vmn2r114 T G 17: 23,291,791 I572L probably benign Het
Vmn2r26 A T 6: 124,026,111 Q160L probably benign Het
Vmn2r75 A C 7: 86,166,167 probably null Het
Vps8 A G 16: 21,461,408 K336E possibly damaging Het
Zfp324 T C 7: 12,969,373 S32P probably benign Het
Zfp366 T C 13: 99,229,495 I388T possibly damaging Het
Zfp68 A T 5: 138,607,337 N203K possibly damaging Het
Zhx2 A T 15: 57,823,587 N784I probably damaging Het
Other mutations in Tmem55b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02310:Tmem55b APN 14 50929210 missense possibly damaging 0.83
R0016:Tmem55b UTSW 14 50928894 missense probably damaging 1.00
R0885:Tmem55b UTSW 14 50930306 missense probably damaging 1.00
R2483:Tmem55b UTSW 14 50930292 missense probably damaging 1.00
R2509:Tmem55b UTSW 14 50929658 nonsense probably null
R4202:Tmem55b UTSW 14 50930655 missense probably damaging 0.97
R5381:Tmem55b UTSW 14 50929038 missense probably benign 0.00
R5629:Tmem55b UTSW 14 50927916 missense probably benign 0.05
R5844:Tmem55b UTSW 14 50929042 missense probably benign 0.03
R5865:Tmem55b UTSW 14 50928875 unclassified probably benign
R7177:Tmem55b UTSW 14 50930177 missense possibly damaging 0.65
R7732:Tmem55b UTSW 14 50930633 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TCGGTCTGTGAATTCTGTCC -3'
(R):5'- AGTGACTTCTCAGCGGATTGC -3'

Sequencing Primer
(F):5'- CGGTCTGTGAATTCTGTCCACTATG -3'
(R):5'- GTGTTCAATCCCAGCACCTGAG -3'
Posted On2016-05-10