Incidental Mutation 'R5008:2310022A10Rik'
List |< first << previous [record 10 of 1826] next >> last >|
ID390283
Institutional Source Beutler Lab
Gene Symbol 2310022A10Rik
Ensembl Gene ENSMUSG00000049643
Gene NameRIKEN cDNA 2310022A10 gene
Synonyms
MMRRC Submission 042599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R5008 (G1)
Quality Score173
Status Validated
Chromosome7
Chromosomal Location27553233-27582099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 27578767 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Arginine at position 242 (T242R)
Ref Sequence ENSEMBL: ENSMUSP00000066803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067386] [ENSMUST00000187032] [ENSMUST00000187960] [ENSMUST00000191126]
Predicted Effect probably damaging
Transcript: ENSMUST00000067386
AA Change: T242R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066803
Gene: ENSMUSG00000049643
AA Change: T242R

DomainStartEndE-ValueType
Blast:SAM 34 100 5e-20 BLAST
SCOP:d1b4fa_ 54 100 7e-5 SMART
low complexity region 164 176 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186501
Predicted Effect probably damaging
Transcript: ENSMUST00000187032
AA Change: T236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139423
Gene: ENSMUSG00000049643
AA Change: T236R

DomainStartEndE-ValueType
Blast:SAM 28 92 4e-20 BLAST
SCOP:d1b4fa_ 48 94 6e-5 SMART
low complexity region 158 170 N/A INTRINSIC
low complexity region 262 271 N/A INTRINSIC
low complexity region 294 319 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187960
AA Change: T242R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140651
Gene: ENSMUSG00000049643
AA Change: T242R

DomainStartEndE-ValueType
Blast:SAM 34 98 4e-20 BLAST
SCOP:d1b4fa_ 54 100 6e-5 SMART
low complexity region 164 176 N/A INTRINSIC
low complexity region 268 277 N/A INTRINSIC
low complexity region 300 325 N/A INTRINSIC
low complexity region 384 392 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190656
AA Change: R154G
Predicted Effect probably benign
Transcript: ENSMUST00000191126
SMART Domains Protein: ENSMUSP00000139696
Gene: ENSMUSG00000049643

DomainStartEndE-ValueType
Blast:SAM 8 74 1e-22 BLAST
SCOP:d1b4fa_ 28 74 4e-5 SMART
low complexity region 138 150 N/A INTRINSIC
Meta Mutation Damage Score 0.0448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (73/75)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057N15Rik A G 16: 88,773,775 Y126H probably damaging Het
Catsperg1 A T 7: 29,195,434 Y579* probably null Het
Chchd5 A T 2: 129,130,399 probably null Het
Chd1l T C 3: 97,583,908 N423D probably damaging Het
Cntnap1 G A 11: 101,188,741 W1268* probably null Het
Col2a1 G A 15: 97,979,669 A1011V probably benign Het
Cst11 A G 2: 148,770,405 I104T probably benign Het
Dctd C T 8: 48,137,414 probably benign Het
Dnah17 A G 11: 118,110,577 F847L probably benign Het
Dspp A T 5: 104,175,573 H194L possibly damaging Het
Dyx1c1 T C 9: 72,972,318 probably benign Het
Frmd5 C A 2: 121,548,860 R503L probably damaging Het
Galnt3 C A 2: 66,085,241 R592L probably benign Het
Gm13128 A G 4: 144,331,266 S148G probably benign Het
Gm38706 T A 6: 130,484,617 noncoding transcript Het
Gm38706 T A 6: 130,485,020 noncoding transcript Het
Hivep3 A G 4: 120,098,917 K1477E probably benign Het
Igsf3 C T 3: 101,450,917 T708M probably damaging Het
Ikzf4 T G 10: 128,641,250 E117A probably benign Het
Klhl28 C T 12: 64,957,227 E171K probably damaging Het
Krt83 T A 15: 101,491,224 I76F probably damaging Het
Lat2 A G 5: 134,603,137 V152A probably benign Het
Lrp12 C T 15: 39,878,456 D307N probably damaging Het
Mdp1 C T 14: 55,659,226 R126Q probably damaging Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Muc6 G A 7: 141,639,559 L1734F probably benign Het
Myh4 T A 11: 67,253,532 S1243T probably benign Het
Myo3b T A 2: 70,258,068 F892I probably damaging Het
Nckap5l T C 15: 99,425,850 N924S possibly damaging Het
Npnt C T 3: 132,906,457 C218Y probably damaging Het
Olfr434 T A 6: 43,217,057 I48N probably damaging Het
Olfr715b A T 7: 107,106,081 M260K probably damaging Het
Olfr8 T A 10: 78,956,071 F289I probably damaging Het
Pfkm G A 15: 98,122,689 C233Y probably benign Het
Pigq A G 17: 25,934,203 V338A probably benign Het
Pld4 A T 12: 112,768,050 N415I possibly damaging Het
Pmm1 A T 15: 81,957,894 V35E probably null Het
Polg G T 7: 79,460,074 P394T probably damaging Het
Polq A T 16: 37,062,387 I1638L probably benign Het
Pros1 A G 16: 62,928,185 N674D possibly damaging Het
Psme4 T A 11: 30,856,896 M107K probably benign Het
Rasa3 A T 8: 13,584,959 C453* probably null Het
Repin1 T C 6: 48,596,608 V101A probably damaging Het
Rnf186 A T 4: 138,967,229 M27L probably benign Het
Rpa1 A G 11: 75,313,299 probably null Het
Rph3a G T 5: 120,945,391 N605K probably damaging Het
Rps18 A T 17: 33,952,284 L107Q probably null Het
Scgn A G 13: 23,990,975 I20T probably damaging Het
Skint6 A T 4: 112,991,255 V652E possibly damaging Het
Slc23a2 T C 2: 132,101,494 H29R probably damaging Het
Slc34a3 C T 2: 25,230,842 V383I possibly damaging Het
Slc5a1 A G 5: 33,152,573 M382V possibly damaging Het
Slc5a3 T A 16: 92,077,281 S75R probably damaging Het
Stat5b G C 11: 100,802,483 H111D probably benign Het
Tanc2 G A 11: 105,625,060 M1I probably null Het
Tbcel C T 9: 42,416,123 G346E probably damaging Het
Tecta C A 9: 42,373,062 R909L possibly damaging Het
Tnip1 A T 11: 54,937,984 M119K probably benign Het
Wdr34 C A 2: 30,032,769 R322L probably benign Het
Zbbx A C 3: 75,151,448 S51A possibly damaging Het
Zc3h12c T C 9: 52,116,700 N454S probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in 2310022A10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:2310022A10Rik APN 7 27564557 missense probably benign 0.05
IGL03261:2310022A10Rik APN 7 27580438 nonsense probably null
R0305:2310022A10Rik UTSW 7 27574636 missense probably damaging 1.00
R1080:2310022A10Rik UTSW 7 27565684 missense probably benign
R1696:2310022A10Rik UTSW 7 27560597 missense possibly damaging 0.94
R1773:2310022A10Rik UTSW 7 27580595 missense probably damaging 0.98
R4171:2310022A10Rik UTSW 7 27565684 missense probably benign
R4583:2310022A10Rik UTSW 7 27574592 missense unknown
R4781:2310022A10Rik UTSW 7 27571651 missense probably damaging 1.00
R4806:2310022A10Rik UTSW 7 27565645 critical splice acceptor site probably null
R4998:2310022A10Rik UTSW 7 27571663 missense probably damaging 1.00
R5000:2310022A10Rik UTSW 7 27556521 missense probably benign 0.04
R5007:2310022A10Rik UTSW 7 27578767 missense probably damaging 1.00
R5364:2310022A10Rik UTSW 7 27578767 missense probably damaging 1.00
R6119:2310022A10Rik UTSW 7 27565713 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCGTGTGTCCCTACTAGG -3'
(R):5'- GACTGGGGCTAAGCTAAAAGTC -3'

Sequencing Primer
(F):5'- CCCTACTAGGACAGTTCTCACTGG -3'
(R):5'- CTGGGGCTAAGCTAAAAGTCAGATG -3'
Posted OnJun 06, 2016