Incidental Mutation 'R5105:Ccdc92'
ID401984
Institutional Source Beutler Lab
Gene Symbol Ccdc92
Ensembl Gene ENSMUSG00000037979
Gene Namecoiled-coil domain containing 92
SynonymsD5Bwg0834e
MMRRC Submission 042693-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5105 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124834418-124862424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124835794 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 224 (P224S)
Ref Sequence ENSEMBL: ENSMUSP00000038075 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036206] [ENSMUST00000058440] [ENSMUST00000135495] [ENSMUST00000141137] [ENSMUST00000143268]
Predicted Effect probably damaging
Transcript: ENSMUST00000036206
AA Change: P224S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038075
Gene: ENSMUSG00000037979
AA Change: P224S

DomainStartEndE-ValueType
Pfam:CCDC92 7 63 1.5e-25 PFAM
low complexity region 72 84 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058440
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135495
SMART Domains Protein: ENSMUSP00000119438
Gene: ENSMUSG00000037979

DomainStartEndE-ValueType
Pfam:CCDC92 6 59 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143268
SMART Domains Protein: ENSMUSP00000114983
Gene: ENSMUSG00000037979

DomainStartEndE-ValueType
Pfam:CCDC92 6 66 2.3e-25 PFAM
low complexity region 72 84 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196708
Meta Mutation Damage Score 0.1831 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik T G 5: 107,510,471 S1124A possibly damaging Het
Camsap1 A G 2: 25,940,929 S445P probably damaging Het
Cep135 T C 5: 76,594,092 V125A probably benign Het
Cep192 T A 18: 67,866,541 C2159S probably benign Het
Col1a1 G T 11: 94,942,385 R404L unknown Het
Col6a3 A T 1: 90,798,140 M1382K possibly damaging Het
Cyp4a12b T C 4: 115,433,761 S329P probably damaging Het
Dclk1 T G 3: 55,255,939 S151A probably benign Het
Ddhd1 A T 14: 45,657,407 V202E probably benign Het
Dlx6 AGG AG 6: 6,865,180 probably null Het
Dnah10 A G 5: 124,811,482 E3050G probably benign Het
Dync1h1 T A 12: 110,617,932 F590I probably damaging Het
Eif4b T C 15: 102,084,196 Y63H probably benign Het
Fscb T C 12: 64,473,336 E452G possibly damaging Het
Gpx3 A T 11: 54,907,154 T39S possibly damaging Het
Grin2b T A 6: 135,732,441 Y1369F probably benign Het
Kank4 A T 4: 98,779,159 N350K probably benign Het
Kdm5d A G Y: 941,752 K1318E probably benign Het
Large1 A T 8: 72,852,244 Y444* probably null Het
Lhx3 TCCTACGGGCCGGCCC TCC 2: 26,201,423 probably null Het
Lrrc47 A G 4: 154,012,216 Q156R probably damaging Het
Lrriq4 T C 3: 30,650,483 L220P probably damaging Het
Matn2 A G 15: 34,355,668 D273G possibly damaging Het
Myo18b T A 5: 112,840,778 I981F probably damaging Het
Olfr1110 A G 2: 87,136,210 I37T probably benign Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr357 G A 2: 36,997,457 probably null Het
Olfr524 A G 7: 140,202,549 Y74H probably damaging Het
Olfr974 T C 9: 39,942,398 V46A probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Ppp3cb A G 14: 20,509,422 V422A possibly damaging Het
Rlf G A 4: 121,150,367 T472I probably damaging Het
Scaf11 T C 15: 96,420,432 E417G probably damaging Het
Shisa2 A T 14: 59,629,814 T172S possibly damaging Het
Siglec1 T A 2: 131,080,400 Q585L possibly damaging Het
Sorcs1 A T 19: 50,225,141 M716K possibly damaging Het
Sparcl1 C T 5: 104,085,763 M573I probably damaging Het
Stxbp5l C A 16: 37,142,372 V774F probably benign Het
Tcaf3 A G 6: 42,591,325 F699S probably damaging Het
Tmem87b T C 2: 128,831,589 V251A probably damaging Het
Trpc6 T A 9: 8,649,470 N560K probably benign Het
Trpv4 T A 5: 114,626,920 I678F probably damaging Het
Ttc3 A T 16: 94,466,934 H1935L possibly damaging Het
Vmn2r59 T A 7: 42,047,105 Y71F probably benign Het
Wdfy3 A G 5: 101,855,549 I2900T probably damaging Het
Zfp184 A G 13: 21,959,629 T502A possibly damaging Het
Zmym6 A G 4: 127,123,758 I1019V probably benign Het
Other mutations in Ccdc92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01737:Ccdc92 APN 5 124835856 missense probably damaging 1.00
IGL03057:Ccdc92 APN 5 124835689 nonsense probably null
IGL03185:Ccdc92 APN 5 124835950 missense probably damaging 0.99
R0801:Ccdc92 UTSW 5 124836271 missense probably benign
R1485:Ccdc92 UTSW 5 124836271 missense probably benign
R1828:Ccdc92 UTSW 5 124836178 missense probably benign 0.00
R4497:Ccdc92 UTSW 5 124836273 missense probably benign 0.17
R8014:Ccdc92 UTSW 5 124836026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCATTCACCTGGTCCACG -3'
(R):5'- TTGCTGAGCTCAAGTGGCAC -3'

Sequencing Primer
(F):5'- ATCTCTCCCTCAGGCTGGG -3'
(R):5'- TCAAGTGGCACCTCGGATG -3'
Posted On2016-07-22