Mutagenetix > Incidental Mutation

Incidental Mutation 'R5192:Pif1'

405095

Institutional Source

Beutler Lab

Gene Symbol

Pif1

Ensembl Gene

ENSMUSG00000041064

Gene Name

PIF1 5'-to-3' DNA helicase

Synonyms

AI449441

MMRRC Submission

042768-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5192 (G1)

Quality Score

165

Status

Not validated

Chromosome

Chromosomal Location

65494442-65503249 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 65495374 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 95 (A95S)

Ref Sequence

ENSEMBL: ENSMUSP00000117085 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047099] [ENSMUST00000131483] [ENSMUST00000134538] [ENSMUST00000136205] [ENSMUST00000141046] [ENSMUST00000154970]

AlphaFold

Q80SX8

Predicted Effect

probably benign
Transcript: ENSMUST00000047099
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000049046
Gene: ENSMUSG00000041064
AA Change: A95S

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131483
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000117494
Gene: ENSMUSG00000041064
AA Change: A95S

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134538
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000122060
Gene: ENSMUSG00000041064
AA Change: A95S

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	426	1.8e-15	PFAM
Pfam:PIF1	215	513	2.1e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136205

Predicted Effect

probably benign
Transcript: ENSMUST00000141046
AA Change: A95S

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000120400
Gene: ENSMUSG00000041064
AA Change: A95S

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152885

Predicted Effect

probably benign
Transcript: ENSMUST00000154970
AA Change: A95S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000117085
Gene: ENSMUSG00000041064
AA Change: A95S

Domain	Start	End	E-Value	Type
low complexity region	125	137	N/A	INTRINSIC
Pfam:AAA_30	215	410	1e-14	PFAM
Pfam:PIF1	215	410	8e-59	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent adenosine triphosphate (ATP)-metabolizing enzyme that functions as a 5' to 3' DNA helicase. The encoded protein can resolve G-quadruplex structures and RNA-DNA hybrids at the ends of chromosomes. It also prevents telomere elongation by inhibiting the actions of telomerase. Alternative splicing and the use of alternative start codons results in multiple isoforms that are differentially localized to either the mitochondria or the nucleus. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal and show no evidence of increased sensitivity to DNA damage, genetic instability, reproducible telomere length alteration or other cellular abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef25	A	G	10: 127,020,978 (GRCm39)	S303P	probably damaging	Het
Babam1	T	C	8: 71,856,897 (GRCm39)	V286A	probably damaging	Het
Becn2	A	G	1: 175,748,408 (GRCm39)	D158G	probably benign	Het
Cep192	T	C	18: 67,968,075 (GRCm39)	I853T	probably benign	Het
Cfap43	A	T	19: 47,814,364 (GRCm39)	W157R	probably damaging	Het
Dnah17	T	C	11: 117,925,185 (GRCm39)	T3883A	possibly damaging	Het
Dzip1	C	T	14: 119,148,805 (GRCm39)	M291I	probably damaging	Het
Eml2	G	A	7: 18,935,088 (GRCm39)	V432I	probably damaging	Het
Fbxw19	T	C	9: 109,313,496 (GRCm39)	Y234C	probably benign	Het
Gask1a	T	G	9: 121,794,727 (GRCm39)	S294A	probably benign	Het
Gm9988	T	C	8: 88,865,001 (GRCm39)		probably benign	Het
Gstm1	A	G	3: 107,922,259 (GRCm39)		probably null	Het
Hsfy2	T	A	1: 56,675,894 (GRCm39)	K214N	probably benign	Het
Kat6a	G	A	8: 23,401,729 (GRCm39)	R366H	probably damaging	Het
Kctd4	A	G	14: 76,200,127 (GRCm39)	T33A	probably benign	Het
Klrh1	T	C	6: 129,748,721 (GRCm39)	T99A	probably benign	Het
Marchf10	T	C	11: 105,262,752 (GRCm39)	H735R	possibly damaging	Het
Myo1g	T	C	11: 6,464,816 (GRCm39)	D486G	probably damaging	Het
Or1e16	AGCGGTCGTAGGC	AGC	11: 73,286,480 (GRCm39)		probably null	Het
Or5d46	A	G	2: 88,170,092 (GRCm39)	Y61C	possibly damaging	Het
Or8b1	T	C	9: 38,400,101 (GRCm39)	Y259H	possibly damaging	Het
Plppr2	T	C	9: 21,852,428 (GRCm39)	F104S	probably damaging	Het
Prep	T	C	10: 45,029,207 (GRCm39)	Y536H	probably benign	Het
Slc22a30	G	A	19: 8,321,757 (GRCm39)	Q436*	probably null	Het
Tmtc2	G	A	10: 105,026,038 (GRCm39)	P810L	probably damaging	Het
Tollip	C	T	7: 141,445,854 (GRCm39)	R9H	probably damaging	Het
Vmn2r57	A	T	7: 41,077,363 (GRCm39)	S268T	probably damaging	Het
Vps51	A	G	19: 6,120,497 (GRCm39)	V472A	possibly damaging	Het
Zfp608	C	A	18: 55,031,569 (GRCm39)	K790N	probably damaging	Het
Zfp661	A	G	2: 127,418,982 (GRCm39)	V386A	possibly damaging	Het

Other mutations in Pif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Pif1	APN	9	65,500,559 (GRCm39)	missense	probably damaging	1.00
IGL01343:Pif1	APN	9	65,496,844 (GRCm39)	missense	probably damaging	1.00
IGL01753:Pif1	APN	9	65,500,590 (GRCm39)	missense	probably damaging	1.00
R0415:Pif1	UTSW	9	65,495,333 (GRCm39)	missense	probably benign	0.00
R1087:Pif1	UTSW	9	65,496,377 (GRCm39)	missense	probably benign
R1742:Pif1	UTSW	9	65,495,132 (GRCm39)	missense	probably benign	0.12
R1861:Pif1	UTSW	9	65,496,735 (GRCm39)	missense	probably damaging	1.00
R3804:Pif1	UTSW	9	65,495,588 (GRCm39)	missense	probably damaging	0.99
R3950:Pif1	UTSW	9	65,499,116 (GRCm39)	missense	probably damaging	1.00
R4457:Pif1	UTSW	9	65,495,058 (GRCm39)	utr 5 prime	probably benign
R4853:Pif1	UTSW	9	65,500,858 (GRCm39)	missense	probably damaging	1.00
R5196:Pif1	UTSW	9	65,495,374 (GRCm39)	missense	probably benign	0.02
R5269:Pif1	UTSW	9	65,499,111 (GRCm39)	missense	possibly damaging	0.82
R6703:Pif1	UTSW	9	65,500,545 (GRCm39)	missense	probably damaging	1.00
R7451:Pif1	UTSW	9	65,495,630 (GRCm39)	missense	probably benign	0.00
R7556:Pif1	UTSW	9	65,496,993 (GRCm39)	critical splice acceptor site	probably null
R7938:Pif1	UTSW	9	65,502,073 (GRCm39)	missense	probably benign	0.01
R8723:Pif1	UTSW	9	65,501,673 (GRCm39)	missense	probably damaging	1.00
R8952:Pif1	UTSW	9	65,499,499 (GRCm39)	missense	probably damaging	1.00
R8968:Pif1	UTSW	9	65,499,076 (GRCm39)	missense	probably damaging	1.00
X0064:Pif1	UTSW	9	65,501,760 (GRCm39)	missense	probably benign	0.21

Predicted Primers

PCR Primer
(F):5'- CGATGAATGTGACGATGCG -3'
(R):5'- GACTGATGGTGACAAAGTCTCGG -3'

Sequencing Primer
(F):5'- TAGCCGTGGAGGAGCTG -3'
(R):5'- TGACAAAGTCTCGGGGCCG -3'

Posted On

2016-07-22