Incidental Mutation 'R5342:Scn2b'
ID422393
Institutional Source Beutler Lab
Gene Symbol Scn2b
Ensembl Gene ENSMUSG00000070304
Gene Namesodium channel, voltage-gated, type II, beta
Synonyms2810451E09Rik, LOC214238
MMRRC Submission 042921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5342 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45117782-45130070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45125518 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 108 (Y108C)
Ref Sequence ENSEMBL: ENSMUSP00000126826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093855] [ENSMUST00000170998]
Predicted Effect probably damaging
Transcript: ENSMUST00000093855
AA Change: Y108C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091377
Gene: ENSMUSG00000070304
AA Change: Y108C

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
IG 35 147 5.93e-6 SMART
transmembrane domain 158 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098827
Predicted Effect probably damaging
Transcript: ENSMUST00000170998
AA Change: Y108C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126826
Gene: ENSMUSG00000070304
AA Change: Y108C

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
IG 35 147 5.93e-6 SMART
transmembrane domain 158 180 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217151
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the beta 2 subunit of the type II voltage-gated sodium channel. The encoded protein is involved in cell-cell adhesion and cell migration. Defects in this gene can be a cause of Brugada Syndrome, atrial fibrillation, or sudden infant death syndrome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display decreased sodium channel density, altered voltage dependence of inactivation, and increased susceptibility to pilocarpine-induced seizures but appear normal in other neurological tests. Impaired glucose tolerance in homozygous mutant males is seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb3 A C 8: 27,226,781 Y392* probably null Het
Arap1 G A 7: 101,404,960 E1330K probably benign Het
Atg2b G T 12: 105,658,916 D600E possibly damaging Het
Atp1b2 C T 11: 69,602,828 V142I probably damaging Het
AW551984 A T 9: 39,594,551 M450K probably damaging Het
BC067074 T C 13: 113,366,269 probably null Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Ccnt2 T C 1: 127,791,733 silent Het
Cdca7l A G 12: 117,877,033 Y430C probably damaging Het
Ces4a A G 8: 105,146,143 T343A probably benign Het
Clec2g C T 6: 128,948,751 A41V probably benign Het
Crybg3 A T 16: 59,522,149 Y2708N probably damaging Het
Dmxl1 A T 18: 49,951,235 E2758V probably damaging Het
Dusp27 T C 1: 166,110,250 E80G probably benign Het
Eci2 C T 13: 34,978,724 E283K probably benign Het
Edrf1 T A 7: 133,651,910 probably null Het
Eif3b T C 5: 140,425,280 L162P probably damaging Het
Ercc3 A G 18: 32,245,595 I210V probably benign Het
Exoc1 A G 5: 76,567,014 N739S probably damaging Het
Gm7334 A G 17: 50,698,754 K23E probably benign Het
Gm7356 T G 17: 14,001,098 D223A possibly damaging Het
Klhl26 A G 8: 70,455,565 L47P probably damaging Het
Klhl42 C T 6: 147,092,286 T252I possibly damaging Het
Morc1 G T 16: 48,618,509 G756W probably damaging Het
Mroh2b G T 15: 4,914,133 E384* probably null Het
Nol10 G A 12: 17,369,620 probably null Het
Nxpe5 T C 5: 138,239,241 L9P probably damaging Het
Olfr457 A G 6: 42,471,902 I92T probably damaging Het
Olfr617 C T 7: 103,584,828 R269C probably benign Het
Olfr857 A G 9: 19,713,037 D70G probably damaging Het
Pak2 T C 16: 32,044,488 E94G probably damaging Het
Pcdha7 A G 18: 36,974,671 K250E possibly damaging Het
Pde8b T C 13: 95,041,990 T541A probably damaging Het
Peg3 A T 7: 6,709,970 I751N probably damaging Het
Prpsap2 T C 11: 61,731,570 D269G probably damaging Het
Raver2 C A 4: 101,102,692 T123K possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Sdr16c6 T C 4: 4,069,923 E139G probably damaging Het
Sgpp2 A G 1: 78,360,188 I68V probably benign Het
Sorbs2 T A 8: 45,796,013 I687N probably damaging Het
Sorcs3 G A 19: 48,796,472 probably null Het
Stk16 T A 1: 75,212,965 C174S probably benign Het
Ttll9 C A 2: 152,991,652 N198K possibly damaging Het
Unc13c A T 9: 73,930,823 D915E probably benign Het
Unc5b T A 10: 60,778,267 K268* probably null Het
Vim T A 2: 13,580,013 probably null Het
Xirp2 T A 2: 67,513,461 N2015K probably damaging Het
Zfp160 T G 17: 21,020,733 M21R possibly damaging Het
Other mutations in Scn2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Scn2b APN 9 45125544 missense probably damaging 1.00
IGL02449:Scn2b APN 9 45125514 missense probably damaging 1.00
IGL03379:Scn2b APN 9 45126200 missense probably damaging 1.00
R2056:Scn2b UTSW 9 45125517 missense probably damaging 0.98
R3856:Scn2b UTSW 9 45125461 missense possibly damaging 0.89
R4578:Scn2b UTSW 9 45126162 missense possibly damaging 0.87
R6208:Scn2b UTSW 9 45118030 missense probably benign 0.01
R7023:Scn2b UTSW 9 45126140 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGGGCCTTCCAGGTCTAATG -3'
(R):5'- AGTGCCCTGAGCTAAGCTGTAG -3'

Sequencing Primer
(F):5'- CCTTCCTTCCCATGTTAAGAAAGAAG -3'
(R):5'- CTGTAGAGAACGGTGAGTGTCCC -3'
Posted On2016-08-04