Incidental Mutation 'R5423:Serpina3g'
ID426721
Institutional Source Beutler Lab
Gene Symbol Serpina3g
Ensembl Gene ENSMUSG00000041481
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3G
SynonymsSpi2-1, 2A2, Spi2A, Spi2/eb.1, alpha-1 antiproteinase,, alpha-1 antiproteinase
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5423 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104236245-104241939 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 104237994 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043315] [ENSMUST00000170628] [ENSMUST00000171916]
Predicted Effect probably benign
Transcript: ENSMUST00000043315
SMART Domains Protein: ENSMUSP00000041250
Gene: ENSMUSG00000041481

DomainStartEndE-ValueType
SERPIN 1 215 1.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171065
Predicted Effect probably benign
Transcript: ENSMUST00000171916
SMART Domains Protein: ENSMUSP00000129633
Gene: ENSMUSG00000041481

DomainStartEndE-ValueType
Pfam:Serpin 1 101 1.3e-31 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired memory T cell homeostatic proliferation, decreased CD8+ T cells and antigen-specific CD8+ T cells after LCMV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vasn C T 16: 4,648,420 P77L probably benign Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Serpina3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Serpina3g APN 12 104241178 missense probably damaging 0.99
IGL02663:Serpina3g APN 12 104239140 missense possibly damaging 0.94
R0047:Serpina3g UTSW 12 104240284 missense possibly damaging 0.69
R0525:Serpina3g UTSW 12 104238339 missense probably damaging 1.00
R0702:Serpina3g UTSW 12 104241253 missense probably damaging 0.96
R1163:Serpina3g UTSW 12 104239292 missense possibly damaging 0.84
R1595:Serpina3g UTSW 12 104239272 missense probably benign 0.16
R1908:Serpina3g UTSW 12 104241277 missense probably damaging 0.96
R2089:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2403:Serpina3g UTSW 12 104241162 missense probably damaging 1.00
R4165:Serpina3g UTSW 12 104240287 missense probably benign 0.00
R4466:Serpina3g UTSW 12 104237923 splice site probably benign
R4669:Serpina3g UTSW 12 104239220 missense probably damaging 1.00
R4735:Serpina3g UTSW 12 104239113 missense probably damaging 1.00
R5552:Serpina3g UTSW 12 104240336 missense probably damaging 0.96
R5605:Serpina3g UTSW 12 104241040 missense probably damaging 1.00
R6384:Serpina3g UTSW 12 104240396 missense probably null 0.34
R6446:Serpina3g UTSW 12 104239082 missense probably damaging 1.00
R7100:Serpina3g UTSW 12 104238311 start gained probably benign
R7869:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7878:Serpina3g UTSW 12 104238102 start gained probably benign
R7952:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7961:Serpina3g UTSW 12 104238102 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTCCGTGAAGTACAAG -3'
(R):5'- AAATCTGCTGTGAAGGCCTC -3'

Sequencing Primer
(F):5'- TCCGTGAAGTACAAGAAAATGTCAC -3'
(R):5'- GGTACAGAGCCCTTGCCTTC -3'
Posted On2016-09-01