Incidental Mutation 'R0702:Serpina3g'
ID63061
Institutional Source Beutler Lab
Gene Symbol Serpina3g
Ensembl Gene ENSMUSG00000041481
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3G
SynonymsSpi2-1, 2A2, Spi2A, Spi2/eb.1, alpha-1 antiproteinase,, alpha-1 antiproteinase
MMRRC Submission 038885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0702 (G1)
Quality Score120
Status Not validated
Chromosome12
Chromosomal Location104236245-104241939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104241253 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 225 (E225G)
Ref Sequence ENSEMBL: ENSMUSP00000041250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043315] [ENSMUST00000170628] [ENSMUST00000171916]
Predicted Effect probably damaging
Transcript: ENSMUST00000043315
AA Change: E225G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041250
Gene: ENSMUSG00000041481
AA Change: E225G

DomainStartEndE-ValueType
SERPIN 1 215 1.09e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171065
Predicted Effect probably benign
Transcript: ENSMUST00000171916
SMART Domains Protein: ENSMUSP00000129633
Gene: ENSMUSG00000041481

DomainStartEndE-ValueType
Pfam:Serpin 1 101 1.3e-31 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired memory T cell homeostatic proliferation, decreased CD8+ T cells and antigen-specific CD8+ T cells after LCMV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd11 A T 8: 122,889,766 I2428N probably damaging Het
Ano9 A G 7: 141,107,282 V348A probably damaging Het
Cfap69 A G 5: 5,644,465 I132T probably benign Het
Chd1l C T 3: 97,566,794 D791N probably benign Het
Chl1 A G 6: 103,706,622 Y819C probably damaging Het
Col5a2 T A 1: 45,380,131 D1263V possibly damaging Het
Csnk1g1 C T 9: 66,010,493 R45W probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dgat2l6 G A X: 100,542,681 V180M probably damaging Het
Fscb G A 12: 64,472,001 P897L unknown Het
Herc6 T C 6: 57,581,107 L24P probably damaging Het
Il23r T A 6: 67,466,285 Q278L probably damaging Het
Kpna4 A T 3: 69,084,105 V361D probably damaging Het
Muc1 A G 3: 89,230,220 D123G probably benign Het
Notch4 A G 17: 34,575,203 Y722C probably damaging Het
Ntng1 G C 3: 109,872,254 R336G probably damaging Het
Olfr199 T C 16: 59,215,699 M305V probably benign Het
Pgbd5 C T 8: 124,374,255 V421M probably benign Het
Prkdc A G 16: 15,785,971 T2950A possibly damaging Het
Proser3 A T 7: 30,539,530 D630E probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Slc2a13 T C 15: 91,321,667 D439G probably benign Het
Srebf2 T C 15: 82,177,409 L352P probably damaging Het
Trpc5 A G X: 144,411,739 V590A probably damaging Het
Ubqln2 A T X: 153,499,669 M406L possibly damaging Het
Other mutations in Serpina3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Serpina3g APN 12 104241178 missense probably damaging 0.99
IGL02663:Serpina3g APN 12 104239140 missense possibly damaging 0.94
R0047:Serpina3g UTSW 12 104240284 missense possibly damaging 0.69
R0525:Serpina3g UTSW 12 104238339 missense probably damaging 1.00
R1163:Serpina3g UTSW 12 104239292 missense possibly damaging 0.84
R1595:Serpina3g UTSW 12 104239272 missense probably benign 0.16
R1908:Serpina3g UTSW 12 104241277 missense probably damaging 0.96
R2089:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2091:Serpina3g UTSW 12 104239158 missense probably damaging 1.00
R2403:Serpina3g UTSW 12 104241162 missense probably damaging 1.00
R4165:Serpina3g UTSW 12 104240287 missense probably benign 0.00
R4466:Serpina3g UTSW 12 104237923 splice site probably benign
R4669:Serpina3g UTSW 12 104239220 missense probably damaging 1.00
R4735:Serpina3g UTSW 12 104239113 missense probably damaging 1.00
R5423:Serpina3g UTSW 12 104237994 utr 5 prime probably benign
R5552:Serpina3g UTSW 12 104240336 missense probably damaging 0.96
R5605:Serpina3g UTSW 12 104241040 missense probably damaging 1.00
R6384:Serpina3g UTSW 12 104240396 missense probably null 0.34
R6446:Serpina3g UTSW 12 104239082 missense probably damaging 1.00
R7100:Serpina3g UTSW 12 104238311 start gained probably benign
R7869:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7878:Serpina3g UTSW 12 104238102 start gained probably benign
R7952:Serpina3g UTSW 12 104240251 missense probably benign 0.05
R7961:Serpina3g UTSW 12 104238102 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGCTCAAGACACTGTTCCTGCC -3'
(R):5'- AGTTAGGAGAGAGCCTCACTGCTG -3'

Sequencing Primer
(F):5'- CACAAGGCTGTGCTGGATG -3'
(R):5'- TAACACAAATTTCAGGTCAGGAAC -3'
Posted On2013-07-30