Incidental Mutation 'R5492:Tigar'
ID432115
Institutional Source Beutler Lab
Gene Symbol Tigar
Ensembl Gene ENSMUSG00000038028
Gene NameTrp53 induced glycolysis repulatory phosphatase
Synonyms9630033F20Rik, Tigar
MMRRC Submission 043053-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5492 (G1)
Quality Score99
Status Not validated
Chromosome6
Chromosomal Location127085116-127109557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127089204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 124 (T124S)
Ref Sequence ENSEMBL: ENSMUSP00000048643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039913] [ENSMUST00000200988]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039913
AA Change: T124S

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048643
Gene: ENSMUSG00000038028
AA Change: T124S

DomainStartEndE-ValueType
PGAM 5 205 8.71e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200988
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.1%
  • 10x: 94.5%
  • 20x: 89.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is regulated as part of the p53 tumor suppressor pathway and encodes a protein with sequence similarity to the bisphosphate domain of the glycolytic enzyme that degrades fructose-2,6-bisphosphate. The protein functions by blocking glycolysis and directing the pathway into the pentose phosphate shunt. Expression of this protein also protects cells from DNA damaging reactive oxygen species and provides some protection from DNA damage-induced apoptosis. The 12p13.32 region that includes this gene is paralogous to the 11q13.3 region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit improved response to myocardial infarction associated with increased autophagy, mitophagy, levels of reactive oxygen species production and decreased mitochondria DNA damage. Mice homozygous for a different allele exhibit impaired crypt regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,545,207 R135C probably damaging Het
Abcd2 A G 15: 91,188,973 Y328H probably benign Het
Abcg4 T C 9: 44,278,058 T381A probably benign Het
Adamts12 A G 15: 11,336,298 N1490D probably benign Het
Aldh18a1 C T 19: 40,551,290 R747Q probably damaging Het
Armc8 G T 9: 99,527,131 C169* probably null Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Bsn G A 9: 108,112,515 P2013S probably damaging Het
Cdc16 A G 8: 13,763,915 probably null Het
Cmtr1 T A 17: 29,690,342 F408L probably damaging Het
Col4a2 C T 8: 11,438,608 R1104W possibly damaging Het
Drg2 A C 11: 60,461,596 H208P probably damaging Het
Frem3 A T 8: 80,612,677 D533V probably damaging Het
Gm9930 T A 10: 9,534,593 noncoding transcript Het
Haus5 A G 7: 30,658,955 V305A possibly damaging Het
Hint3 C A 10: 30,618,249 R30L probably benign Het
Hltf T A 3: 20,098,067 probably null Het
Hmcn2 T A 2: 31,420,306 L3304Q probably benign Het
Hspa2 A G 12: 76,404,534 M1V probably null Het
Htr5b T C 1: 121,527,658 T178A possibly damaging Het
Ighv1-11 A G 12: 114,612,464 S44P probably damaging Het
Larp1b C T 3: 40,969,899 R104W probably damaging Het
Map3k2 A G 18: 32,228,136 T550A probably damaging Het
Map4 T A 9: 110,052,382 S105T possibly damaging Het
Mgam T C 6: 40,756,363 C691R probably damaging Het
Mms19 A G 19: 41,955,831 I310T possibly damaging Het
Myh2 A C 11: 67,180,875 K506T probably benign Het
Ngdn T C 14: 55,023,052 V239A probably benign Het
Plin1 G A 7: 79,725,712 R151* probably null Het
Rbpjl GCC GC 2: 164,414,410 probably null Het
Rdh16f2 G T 10: 127,866,754 E67* probably null Het
Slc25a36 A C 9: 97,100,206 C25W probably damaging Het
Stk31 G A 6: 49,398,243 A49T probably damaging Het
Tsn A G 1: 118,304,713 V144A probably damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Zfp943 T A 17: 21,993,075 C381S probably damaging Het
Zfyve19 A T 2: 119,209,114 probably benign Het
Other mutations in Tigar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Tigar APN 6 127088079 missense probably damaging 0.98
IGL01099:Tigar APN 6 127088145 missense probably benign
IGL02021:Tigar APN 6 127089290 missense probably damaging 0.97
R0356:Tigar UTSW 6 127091182 critical splice donor site probably null
R1972:Tigar UTSW 6 127087926 missense possibly damaging 0.62
R6063:Tigar UTSW 6 127091201 missense probably benign 0.00
R7447:Tigar UTSW 6 127088166 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTTGCTGATTCCCAGTGAC -3'
(R):5'- GCATAGTGTCAGGTTCTCACAGG -3'

Sequencing Primer
(F):5'- TGCTGATTCCCAGTGACTGAGAC -3'
(R):5'- ACAGGCCTTTACCATCATGTCG -3'
Posted On2016-10-05