Incidental Mutation 'R5559:Gchfr'
ID436443
Institutional Source Beutler Lab
Gene Symbol Gchfr
Ensembl Gene ENSMUSG00000046814
Gene NameGTP cyclohydrolase I feedback regulator
SynonymsP35, 2010323F13Rik
MMRRC Submission 043116-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R5559 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119167773-119172390 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119169706 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 23 (H23Y)
Ref Sequence ENSEMBL: ENSMUSP00000060835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038439] [ENSMUST00000057454] [ENSMUST00000069711]
Predicted Effect probably benign
Transcript: ENSMUST00000038439
SMART Domains Protein: ENSMUSP00000041841
Gene: ENSMUSG00000034278

DomainStartEndE-ValueType
DnaJ 10 68 3.66e-21 SMART
coiled coil region 112 151 N/A INTRINSIC
low complexity region 172 181 N/A INTRINSIC
Pfam:RRM_1 187 243 1.8e-6 PFAM
Pfam:RRM_5 194 246 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057454
AA Change: H23Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060835
Gene: ENSMUSG00000046814
AA Change: H23Y

DomainStartEndE-ValueType
Pfam:GFRP 2 84 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069711
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GTP cyclohydrolase I feedback regulatory protein binds to and mediates tetrahydrobiopterin inhibition of GTP cyclohydrolase I. The regulatory protein, GCHFR, consists of a homodimer. It is postulated that GCHFR may play a role in regulating phenylalanine metabolism in the liver and in the production of biogenic amine neurotransmitters and nitric oxide. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dcp2 C A 18: 44,405,487 P206T probably damaging Het
Dhx57 A T 17: 80,254,379 V902E possibly damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Gm8251 C G 1: 44,058,515 R1141T possibly damaging Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Ighv5-9-1 A T 12: 113,736,125 Y122* probably null Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Sp1 T A 15: 102,408,930 S295T probably benign Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Gchfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Gchfr APN 2 119169748 missense probably damaging 1.00
R0360:Gchfr UTSW 2 119167846 nonsense probably null
R1579:Gchfr UTSW 2 119172021 missense possibly damaging 0.89
R7031:Gchfr UTSW 2 119169755 missense probably benign 0.38
Z1177:Gchfr UTSW 2 119169745 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCAGCCTTTTGGGAAG -3'
(R):5'- AACTCTCTTTGGTGATCTGGGC -3'

Sequencing Primer
(F):5'- CCTTTTGGGAAGTTAGGGAGGACC -3'
(R):5'- TGAGGACGAGCAAGCCCTC -3'
Posted On2016-10-24