Mutagenetix > Incidental Mutation

Incidental Mutation 'R5559:Anapc1'

436444

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

Apc1, tsg24, Mcpr, 2610021O03Rik

MMRRC Submission

043116-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5559 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128452024-128529311 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 128522354 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 129 (C129*)

Ref Sequence

ENSEMBL: ENSMUSP00000105962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110332] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably null
Transcript: ENSMUST00000014499
AA Change: C129*

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: C129*

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110332

Predicted Effect

probably null
Transcript: ENSMUST00000110333
AA Change: C129*

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: C129*

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134485

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	G	T	16: 88,555,981 (GRCm39)	R65L	unknown	Het
Abcc5	A	T	16: 20,157,636 (GRCm39)	M1307K	probably damaging	Het
Brd10	A	C	19: 29,694,363 (GRCm39)	F1710C	possibly damaging	Het
Brox	A	T	1: 183,073,552 (GRCm39)	S39R	possibly damaging	Het
Ccdc168	C	G	1: 44,097,675 (GRCm39)	R1141T	possibly damaging	Het
Cd109	T	C	9: 78,568,250 (GRCm39)	V310A	probably benign	Het
Chd9	G	A	8: 91,742,553 (GRCm39)		probably null	Het
Chmp2b	A	T	16: 65,337,316 (GRCm39)	I170N	probably damaging	Het
Cnp	G	T	11: 100,467,243 (GRCm39)	G62V	probably damaging	Het
Dcp2	C	A	18: 44,538,554 (GRCm39)	P206T	probably damaging	Het
Dhx57	A	T	17: 80,561,808 (GRCm39)	V902E	possibly damaging	Het
Dmwd	G	A	7: 18,814,363 (GRCm39)	V338M	probably damaging	Het
Eva1c	A	G	16: 90,701,139 (GRCm39)	D258G	probably benign	Het
Flvcr2	T	A	12: 85,851,181 (GRCm39)	F448L	probably benign	Het
Garin5b	A	G	7: 4,761,449 (GRCm39)	V421A	probably damaging	Het
Gchfr	C	T	2: 119,000,187 (GRCm39)	H23Y	probably benign	Het
Helz2	T	A	2: 180,871,919 (GRCm39)	M2617L	probably damaging	Het
Ighv5-9-1	A	T	12: 113,699,745 (GRCm39)	Y122*	probably null	Het
Lrrtm3	A	G	10: 63,766,045 (GRCm39)	I514T	probably benign	Het
Nolc1	GAGCAGCAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGCAGCAGC	19: 46,071,594 (GRCm39)		probably benign	Het
Obox5	A	T	7: 15,491,522 (GRCm39)	I21F	probably benign	Het
Or51f1	C	T	7: 102,506,414 (GRCm39)	G25D	possibly damaging	Het
P2rx2	T	C	5: 110,488,427 (GRCm39)	I376V	possibly damaging	Het
Poli	A	G	18: 70,642,356 (GRCm39)	S529P	probably benign	Het
Ruvbl1	T	C	6: 88,450,078 (GRCm39)	I83T	possibly damaging	Het
Rwdd2a	T	C	9: 86,456,483 (GRCm39)	S220P	probably damaging	Het
Serpinb9h	T	A	13: 33,588,301 (GRCm39)	D295E	probably benign	Het
Sf3b3	A	T	8: 111,564,847 (GRCm39)	D320E	probably benign	Het
Slc6a21	C	A	7: 44,937,853 (GRCm39)	L390I	possibly damaging	Het
Smarcd1	T	G	15: 99,601,176 (GRCm39)		probably null	Het
Sp1	T	A	15: 102,317,365 (GRCm39)	S295T	probably benign	Het
Tas2r104	T	A	6: 131,662,094 (GRCm39)	H205L	probably damaging	Het
Tmem69	C	G	4: 116,410,388 (GRCm39)	G194A	probably damaging	Het
Unc5c	G	T	3: 141,509,548 (GRCm39)	C676F	probably damaging	Het
Unkl	A	G	17: 25,424,687 (GRCm39)	N52S	probably benign	Het
Vmn1r233	T	C	17: 21,214,839 (GRCm39)	Y37C	possibly damaging	Het
Vmn1r57	A	G	7: 5,223,898 (GRCm39)	N141S	probably damaging	Het
Vmn2r50	T	C	7: 9,771,253 (GRCm39)	Y816C	probably damaging	Het
Vmn2r51	T	A	7: 9,826,128 (GRCm39)	S540C	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,487,050 (GRCm39)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,505,904 (GRCm39)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,471,649 (GRCm39)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,475,328 (GRCm39)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,495,090 (GRCm39)	missense	probably benign
IGL02089:Anapc1	APN	2	128,505,853 (GRCm39)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,501,772 (GRCm39)	missense	probably benign
IGL02570:Anapc1	APN	2	128,487,120 (GRCm39)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,465,851 (GRCm39)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,501,705 (GRCm39)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,469,117 (GRCm39)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,469,033 (GRCm39)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,465,854 (GRCm39)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,520,138 (GRCm39)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,465,886 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,476,631 (GRCm39)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,483,260 (GRCm39)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,510,963 (GRCm39)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,474,575 (GRCm39)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,461,252 (GRCm39)	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128,459,651 (GRCm39)	missense	probably benign
R1175:Anapc1	UTSW	2	128,522,108 (GRCm39)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,459,617 (GRCm39)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,459,476 (GRCm39)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,466,819 (GRCm39)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,459,636 (GRCm39)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,470,452 (GRCm39)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,500,166 (GRCm39)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,518,128 (GRCm39)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,517,810 (GRCm39)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,501,708 (GRCm39)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,475,335 (GRCm39)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,511,608 (GRCm39)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,490,378 (GRCm39)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,484,468 (GRCm39)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,522,057 (GRCm39)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,484,602 (GRCm39)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,484,439 (GRCm39)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,469,149 (GRCm39)	intron	probably benign
R4359:Anapc1	UTSW	2	128,465,476 (GRCm39)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,518,169 (GRCm39)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,469,115 (GRCm39)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,505,925 (GRCm39)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,527,980 (GRCm39)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,470,610 (GRCm39)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,526,514 (GRCm39)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,449,095 (GRCm39)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,471,469 (GRCm39)	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128,501,837 (GRCm39)	missense	probably benign
R5271:Anapc1	UTSW	2	128,527,905 (GRCm39)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,492,114 (GRCm39)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,517,621 (GRCm39)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,449,115 (GRCm39)	unclassified	probably benign
R5631:Anapc1	UTSW	2	128,499,137 (GRCm39)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,466,836 (GRCm39)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,448,957 (GRCm39)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,492,292 (GRCm39)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,514,055 (GRCm39)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,505,919 (GRCm39)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,526,454 (GRCm39)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,501,657 (GRCm39)	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128,501,688 (GRCm39)	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128,511,820 (GRCm39)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,490,601 (GRCm39)	splice site	probably null
R7041:Anapc1	UTSW	2	128,470,576 (GRCm39)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,457,350 (GRCm39)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,520,194 (GRCm39)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,516,522 (GRCm39)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,454,930 (GRCm39)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,516,604 (GRCm39)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,483,457 (GRCm39)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,526,528 (GRCm39)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,511,828 (GRCm39)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,516,513 (GRCm39)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,490,408 (GRCm39)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,474,547 (GRCm39)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,461,837 (GRCm39)	nonsense	probably null
R8402:Anapc1	UTSW	2	128,472,148 (GRCm39)	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128,517,757 (GRCm39)	missense	probably benign
R8425:Anapc1	UTSW	2	128,511,788 (GRCm39)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,500,264 (GRCm39)	splice site	probably null
R8553:Anapc1	UTSW	2	128,461,833 (GRCm39)	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128,527,748 (GRCm39)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,483,373 (GRCm39)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,483,369 (GRCm39)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,464,333 (GRCm39)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,505,952 (GRCm39)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,483,322 (GRCm39)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,476,628 (GRCm39)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,464,426 (GRCm39)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,465,422 (GRCm39)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,464,420 (GRCm39)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,459,642 (GRCm39)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,476,598 (GRCm39)	missense	probably benign
R9436:Anapc1	UTSW	2	128,518,045 (GRCm39)	missense	probably benign
R9516:Anapc1	UTSW	2	128,517,633 (GRCm39)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,505,980 (GRCm39)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,505,976 (GRCm39)	missense	probably benign
R9757:Anapc1	UTSW	2	128,517,676 (GRCm39)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,500,221 (GRCm39)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,516,621 (GRCm39)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGCTCTCTGAAAGGAAACAGTAC -3'
(R):5'- CTTGCTCAGTTCCGTGATATGTATG -3'

Sequencing Primer
(F):5'- GGTTGTTTATTTTCCTGCAAAGC -3'
(R):5'- CCGTGATATGTATGTATATGTGTGTG -3'

Posted On

2016-10-24