Incidental Mutation 'R5563:Mfsd4b2'
ID436710
Institutional Source Beutler Lab
Gene Symbol Mfsd4b2
Ensembl Gene ENSMUSG00000039339
Gene Namemajor facilitator superfamily domain containing 4B2
Synonyms2010001E11Rik
MMRRC Submission 043120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5563 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location39920382-39926923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39922042 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 106 (E106K)
Ref Sequence ENSEMBL: ENSMUSP00000040384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045526]
Predicted Effect probably benign
Transcript: ENSMUST00000045526
AA Change: E106K

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000040384
Gene: ENSMUSG00000039339
AA Change: E106K

DomainStartEndE-ValueType
Pfam:MFS_1 1 322 3.9e-11 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Ighv3-1 T A 12: 113,964,586 Y51F probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Parp6 G A 9: 59,628,673 probably null Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Prtg G A 9: 72,856,898 R551H probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Uba5 G T 9: 104,049,247 T372K probably benign Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Vmn2r68 T C 7: 85,222,075 T667A probably damaging Het
Other mutations in Mfsd4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Mfsd4b2 APN 10 39925061 splice site probably benign
IGL01546:Mfsd4b2 APN 10 39921475 missense probably damaging 1.00
IGL01662:Mfsd4b2 APN 10 39922197 splice site probably benign
IGL02151:Mfsd4b2 APN 10 39921691 missense probably damaging 1.00
R1928:Mfsd4b2 UTSW 10 39921462 missense probably damaging 1.00
R2851:Mfsd4b2 UTSW 10 39922123 missense probably benign 0.07
R3777:Mfsd4b2 UTSW 10 39921531 missense possibly damaging 0.54
R5055:Mfsd4b2 UTSW 10 39923777 missense possibly damaging 0.79
R5257:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5258:Mfsd4b2 UTSW 10 39922021 missense probably benign 0.00
R5728:Mfsd4b2 UTSW 10 39923795 missense possibly damaging 0.47
R5888:Mfsd4b2 UTSW 10 39922035 missense probably benign 0.00
R6147:Mfsd4b2 UTSW 10 39921577 missense probably benign
R6362:Mfsd4b2 UTSW 10 39921609 missense probably damaging 1.00
R7462:Mfsd4b2 UTSW 10 39921881 missense probably benign 0.03
R7801:Mfsd4b2 UTSW 10 39923781 missense probably benign 0.00
R8126:Mfsd4b2 UTSW 10 39921988 missense probably benign
R8158:Mfsd4b2 UTSW 10 39922068 missense probably benign 0.35
Z1176:Mfsd4b2 UTSW 10 39921600 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCCCTCAGTAGATGCTCTGG -3'
(R):5'- AGAGGGGCTCTTGTATAAACTTAG -3'

Sequencing Primer
(F):5'- CATATGCCCACAGCAGAT -3'
(R):5'- GGGCTCTTGTATAAACTTAGAATGTC -3'
Posted On2016-10-24