Incidental Mutation 'R5563:Ighv3-1'
ID 436714
Institutional Source Beutler Lab
Gene Symbol Ighv3-1
Ensembl Gene ENSMUSG00000093838
Gene Name immunoglobulin heavy variable 3-1
Synonyms Gm16610
MMRRC Submission 043120-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R5563 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 113964388-113964818 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113964586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 51 (Y51F)
Ref Sequence ENSEMBL: ENSMUSP00000100259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103478]
AlphaFold A0A075B5S6
Predicted Effect probably benign
Transcript: ENSMUST00000103478
AA Change: Y51F

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000100259
Gene: ENSMUSG00000093838
AA Change: Y51F

DomainStartEndE-ValueType
IGv 35 116 9.51e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192729
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abraxas1 C T 5: 100,812,174 R104H possibly damaging Het
Actn3 T C 19: 4,872,316 H101R probably damaging Het
Akp3 T C 1: 87,125,924 S174P probably damaging Het
Aldh5a1 C A 13: 24,918,626 A285S possibly damaging Het
Atp7b G A 8: 22,028,714 P36L possibly damaging Het
Cdh20 C T 1: 104,947,357 P288L probably benign Het
Fktn T A 4: 53,761,327 N481K probably damaging Het
Fmo5 C A 3: 97,638,891 H173Q probably damaging Het
Fnip1 A G 11: 54,504,862 R1021G probably benign Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Grin2a A G 16: 9,707,717 F337L probably benign Het
Jcad A G 18: 4,673,944 K569E possibly damaging Het
Mars T C 10: 127,308,661 Q170R probably benign Het
Mfsd4b2 C T 10: 39,922,042 E106K probably benign Het
Mical2 A G 7: 112,314,978 D285G probably damaging Het
Mpp4 A G 1: 59,124,629 probably null Het
Npat A G 9: 53,563,127 I740V probably damaging Het
Parp6 G A 9: 59,628,673 probably null Het
Plin2 T C 4: 86,662,104 K140R probably benign Het
Prdm2 T C 4: 143,134,630 T697A probably benign Het
Prkaa1 A G 15: 5,169,956 E179G probably damaging Het
Prtg G A 9: 72,856,898 R551H probably damaging Het
Psd4 A G 2: 24,394,885 R254G probably benign Het
Rhpn2 T A 7: 35,371,227 L194H probably damaging Het
Sp7 T C 15: 102,359,320 D17G possibly damaging Het
Topbp1 T C 9: 103,311,513 V128A possibly damaging Het
Uba5 G T 9: 104,049,247 T372K probably benign Het
Vmn2r13 T A 5: 109,173,980 I284L probably benign Het
Vmn2r68 T C 7: 85,222,075 T667A probably damaging Het
Other mutations in Ighv3-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4458001:Ighv3-1 UTSW 12 113964604 missense probably benign 0.03
R4077:Ighv3-1 UTSW 12 113964487 missense probably damaging 0.97
R5438:Ighv3-1 UTSW 12 113964469 missense probably benign
R7748:Ighv3-1 UTSW 12 113964650 missense probably damaging 0.98
R8460:Ighv3-1 UTSW 12 113964436 nonsense probably null
R9117:Ighv3-1 UTSW 12 113964469 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCACACTGTGTCTCTTGCACAG -3'
(R):5'- ACAGCCTTTCCTGGTGAGTG -3'

Sequencing Primer
(F):5'- CACAGTAATATGTGGCTGTGTCCTC -3'
(R):5'- CCTGGTGAGTGTTGACATTTCATAC -3'
Posted On 2016-10-24