Incidental Mutation 'R5638:Socs2'
ID 440500
Institutional Source Beutler Lab
Gene Symbol Socs2
Ensembl Gene ENSMUSG00000020027
Gene Name suppressor of cytokine signaling 2
Synonyms SOCS-2, D130043N08Rik, STAT-induced STAT inhibitor 2, Cish2, JAB, cytokine-inducible SH2 protein 2, SSI-2, CIS2
MMRRC Submission 043168-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.193) question?
Stock # R5638 (G1)
Quality Score 224
Status Not validated
Chromosome 10
Chromosomal Location 95221224-95253042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95228745 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 168 (I168M)
Gene Model predicted gene model for transcript(s):
AlphaFold O35717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130784
Predicted Effect unknown
Transcript: ENSMUST00000139210
AA Change: I168M
SMART Domains Protein: ENSMUSP00000121305
Gene: ENSMUSG00000020027
AA Change: I168M

DomainStartEndE-ValueType
SH2 1 89 5.07e-20 SMART
SOCS 108 149 3.15e-16 SMART
SOCS_box 114 148 1.06e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutations in this gene cause accelerated postnatal growth. Homozygotes for a targeted mutation also show increased bone growth, enlargement of most organs, collagen deposition in the skin and some ducts and vessels, lower major urinary protein levels, and elevated IGF-I mRNA levels in some tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik G A 10: 76,288,729 (GRCm39) A96T probably benign Het
A930018M24Rik T C 14: 51,134,414 (GRCm39) D76G possibly damaging Het
Adamtsl3 A T 7: 82,260,958 (GRCm39) R1631W probably damaging Het
Alg5 C T 3: 54,646,254 (GRCm39) H40Y probably benign Het
B3galt1 T C 2: 67,949,095 (GRCm39) L270P probably damaging Het
Ceacam3 A G 7: 16,893,860 (GRCm39) Y457C probably damaging Het
Cenpa A T 5: 30,830,736 (GRCm39) R124W probably damaging Het
Cfap44 A G 16: 44,275,894 (GRCm39) T1385A possibly damaging Het
Chd9 A T 8: 91,738,078 (GRCm39) H1570L possibly damaging Het
Cmtm4 T C 8: 105,084,356 (GRCm39) I113V probably benign Het
Dmxl1 T C 18: 50,024,693 (GRCm39) I1789T possibly damaging Het
Dpf3 G A 12: 83,371,714 (GRCm39) R174W probably damaging Het
Dusp26 T C 8: 31,584,169 (GRCm39) L92P probably damaging Het
Fndc7 T A 3: 108,770,208 (GRCm39) T659S possibly damaging Het
Fry A G 5: 150,282,546 (GRCm39) H357R possibly damaging Het
G0s2 A T 1: 192,954,859 (GRCm39) L75H probably damaging Het
Gm5493 A G 17: 22,969,065 (GRCm39) T82A probably benign Het
Herc2 T C 7: 55,854,164 (GRCm39) V3690A probably benign Het
Igf2bp3 C A 6: 49,064,734 (GRCm39) V537F probably damaging Het
Kntc1 C T 5: 123,956,538 (GRCm39) R2101W possibly damaging Het
Kpna2rt T C 17: 90,217,635 (GRCm39) E37G probably damaging Het
Mrgpra6 G T 7: 46,835,657 (GRCm39) P255T probably damaging Het
Ncor2 A G 5: 125,125,364 (GRCm39) V229A probably benign Het
Nos1ap T A 1: 170,176,968 (GRCm39) K145M probably damaging Het
Or6c210 T A 10: 129,495,969 (GRCm39) I98K possibly damaging Het
Or7g21 T A 9: 19,032,676 (GRCm39) C142S probably benign Het
Ppt2 C A 17: 34,844,823 (GRCm39) M140I probably benign Het
Ppwd1 A G 13: 104,356,906 (GRCm39) I203T probably damaging Het
Prpf6 A G 2: 181,287,381 (GRCm39) T589A probably benign Het
Psd4 T C 2: 24,287,427 (GRCm39) L453P probably benign Het
Ptpn14 A G 1: 189,519,038 (GRCm39) T23A probably damaging Het
Rxrb T C 17: 34,256,381 (GRCm39) L374P probably damaging Het
Scaf4 T C 16: 90,041,198 (GRCm39) E710G unknown Het
Sik1 C T 17: 32,069,802 (GRCm39) V216I probably damaging Het
Skint8 C A 4: 111,807,390 (GRCm39) L359M probably damaging Het
Slc30a5 T A 13: 100,950,380 (GRCm39) K236* probably null Het
Slc38a4 A C 15: 96,910,871 (GRCm39) S135A probably damaging Het
Slc9a1 T A 4: 133,139,571 (GRCm39) V263D probably damaging Het
Spag9 C A 11: 93,959,838 (GRCm39) D342E probably damaging Het
Sspo T C 6: 48,469,825 (GRCm39) S4508P possibly damaging Het
Stat5b C A 11: 100,675,080 (GRCm39) E710* probably null Het
Stip1 G A 19: 7,009,883 (GRCm39) P213L probably damaging Het
Tarbp1 A T 8: 127,177,425 (GRCm39) L749Q probably damaging Het
Thsd7b T G 1: 129,523,270 (GRCm39) S24R probably benign Het
Upp2 T C 2: 58,680,107 (GRCm39) V293A probably damaging Het
Vmn2r65 C T 7: 84,590,047 (GRCm39) C623Y probably damaging Het
Vps54 T C 11: 21,258,799 (GRCm39) V742A probably damaging Het
Other mutations in Socs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03064:Socs2 APN 10 95,248,713 (GRCm39) nonsense probably null
samson UTSW 10 95,248,943 (GRCm39) nonsense probably null
R1412:Socs2 UTSW 10 95,250,780 (GRCm39) missense probably benign
R1617:Socs2 UTSW 10 95,248,943 (GRCm39) nonsense probably null
R1921:Socs2 UTSW 10 95,248,900 (GRCm39) nonsense probably null
R5261:Socs2 UTSW 10 95,228,681 (GRCm39) missense unknown
R7689:Socs2 UTSW 10 95,250,845 (GRCm39) start gained probably benign
R7957:Socs2 UTSW 10 95,250,812 (GRCm39) missense probably benign 0.11
R8744:Socs2 UTSW 10 95,228,662 (GRCm39) missense
R9027:Socs2 UTSW 10 95,248,948 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACGACCTTGCTTGAGAGTATAG -3'
(R):5'- ATCCATAGGAAGGGGCTTGG -3'

Sequencing Primer
(F):5'- CCTTGCTTGAGAGTATAGATTAAACC -3'
(R):5'- AGAAGACTGGATCCCCTTGCTATG -3'
Posted On 2016-11-08