Incidental Mutation 'R5771:Etv4'
ID445387
Institutional Source Beutler Lab
Gene Symbol Etv4
Ensembl Gene ENSMUSG00000017724
Gene Nameets variant 4
SynonymsPea3, Pea-3
MMRRC Submission 043371-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.539) question?
Stock #R5771 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101769742-101785371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101771456 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 335 (P335S)
Ref Sequence ENSEMBL: ENSMUSP00000129261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017868] [ENSMUST00000039152] [ENSMUST00000107176] [ENSMUST00000129741] [ENSMUST00000164750]
Predicted Effect probably damaging
Transcript: ENSMUST00000017868
AA Change: P336S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017868
Gene: ENSMUSG00000017724
AA Change: P336S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 5 341 6.5e-121 PFAM
ETS 342 427 2.4e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039152
SMART Domains Protein: ENSMUSP00000037251
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 168 240 N/A INTRINSIC
low complexity region 244 254 N/A INTRINSIC
S1 287 360 3.52e-18 SMART
low complexity region 453 469 N/A INTRINSIC
coiled coil region 496 525 N/A INTRINSIC
DEXDc 587 771 7.26e-33 SMART
HELICc 815 919 7.45e-21 SMART
HA2 980 1070 1.34e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107176
AA Change: P330S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102794
Gene: ENSMUSG00000017724
AA Change: P330S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 6 335 2.7e-118 PFAM
ETS 336 421 2.4e-56 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129160
Predicted Effect probably benign
Transcript: ENSMUST00000129741
SMART Domains Protein: ENSMUSP00000119430
Gene: ENSMUSG00000034931

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 115 187 N/A INTRINSIC
low complexity region 191 201 N/A INTRINSIC
S1 234 307 3.52e-18 SMART
low complexity region 400 416 N/A INTRINSIC
coiled coil region 443 472 N/A INTRINSIC
DEXDc 534 718 7.26e-33 SMART
HELICc 762 866 7.45e-21 SMART
HA2 927 1017 1.34e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149099
Predicted Effect probably damaging
Transcript: ENSMUST00000164750
AA Change: P335S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129261
Gene: ENSMUSG00000017724
AA Change: P335S

DomainStartEndE-ValueType
Pfam:ETS_PEA3_N 6 340 5.1e-121 PFAM
ETS 341 426 2.4e-56 SMART
Meta Mutation Damage Score 0.4143 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 95% (87/92)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to failure to ejaculate, impaired branching of motor neurons, and abnormal mammary gland terminal differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,291,411 N1091K probably damaging Het
Adam3 C T 8: 24,707,411 V335I probably benign Het
AI504432 G A 3: 107,048,983 noncoding transcript Het
Apcdd1 A G 18: 62,936,956 Y98C probably damaging Het
Aqp9 C T 9: 71,122,864 A214T probably damaging Het
Atp8b4 T C 2: 126,378,744 D578G probably benign Het
Bcdin3d T C 15: 99,470,836 M161V probably benign Het
Bicral C T 17: 46,825,358 V309I possibly damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdhr2 T A 13: 54,726,695 V860E probably damaging Het
Clhc1 A T 11: 29,563,854 N302Y possibly damaging Het
Cnnm2 T A 19: 46,856,995 probably null Het
Crebbp T C 16: 4,119,772 N709S probably benign Het
Ctnnal1 T C 4: 56,826,328 S512G probably benign Het
Dgcr8 C T 16: 18,272,768 V581I probably benign Het
Dnah7c G A 1: 46,639,665 V1790I probably benign Het
Efl1 A G 7: 82,692,524 K452E probably benign Het
Epb42 A C 2: 121,021,820 V564G probably damaging Het
Fbxw9 T A 8: 85,064,572 probably null Het
Fcrls A T 3: 87,263,468 L3Q probably damaging Het
Frmd8 C A 19: 5,869,450 A190S probably benign Het
Gcm2 C T 13: 41,103,515 D253N probably benign Het
Gfm1 T C 3: 67,435,562 V143A probably benign Het
Gigyf2 T C 1: 87,446,328 M1226T possibly damaging Het
Gm10110 C T 14: 89,897,239 noncoding transcript Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm13757 A T 2: 88,446,308 V210D possibly damaging Het
Gm20939 T G 17: 94,874,339 C55W possibly damaging Het
Gm5407 T A 16: 49,296,866 noncoding transcript Het
Golga4 A G 9: 118,558,283 E1491G probably damaging Het
Hdac11 T A 6: 91,169,382 probably null Het
Hs3st3b1 C T 11: 63,889,272 S343N probably benign Het
Igkv12-44 G A 6: 69,815,091 P4S probably benign Het
Igkv1-35 C T 6: 70,011,247 V22I probably benign Het
Kcns2 A T 15: 34,838,922 T144S probably benign Het
Khdc1c T C 1: 21,369,042 V84A possibly damaging Het
Kif4-ps T A 12: 101,149,285 noncoding transcript Het
Lamc2 T G 1: 153,141,594 Y549S probably benign Het
Lect2 T A 13: 56,548,341 I8F probably benign Het
Loxl3 T A 6: 83,035,799 probably null Het
Lrwd1 A T 5: 136,123,662 I545N possibly damaging Het
Ltbp3 T C 19: 5,747,544 C437R probably damaging Het
Lypd3 T C 7: 24,640,362 S285P probably benign Het
Mast2 T A 4: 116,333,425 H83L possibly damaging Het
Mfsd4b4 A G 10: 39,892,639 F153L probably benign Het
Ms4a4b T A 19: 11,461,242 probably null Het
Nbr1 T A 11: 101,559,538 L41Q probably damaging Het
Nlrp4a G A 7: 26,453,389 C628Y probably damaging Het
Nup160 C T 2: 90,723,396 R1157C probably damaging Het
Obscn T A 11: 59,000,707 I7000F unknown Het
Olfr1287 T A 2: 111,450,061 probably null Het
Olfr1484 T G 19: 13,585,508 V25G probably damaging Het
Olfr194 TGAAGAAGAA TGAAGAA 16: 59,119,972 probably benign Het
Olfr229 A T 9: 39,910,250 Y149F probably damaging Het
Pdilt T C 7: 119,494,994 K345E probably damaging Het
Ppp1r12b A T 1: 134,773,424 probably null Het
Ppp2r1b A T 9: 50,866,832 Q219L probably damaging Het
Prim2 A G 1: 33,454,151 S485P unknown Het
Prkdc A G 16: 15,664,233 D380G probably damaging Het
Psmg1 A G 16: 95,982,169 L243S probably damaging Het
Rapgef5 T A 12: 117,721,326 V270D probably benign Het
Rnft1 C T 11: 86,493,206 R311* probably null Het
Scaper T A 9: 55,816,791 I628L probably damaging Het
Serpina3j C A 12: 104,314,926 H119Q possibly damaging Het
Slamf6 G A 1: 171,917,774 V23I probably damaging Het
Slc12a5 T A 2: 164,973,768 M45K possibly damaging Het
Slc25a11 A C 11: 70,646,190 V13G probably damaging Het
Slc7a14 T A 3: 31,238,707 Y143F probably damaging Het
Spryd3 A G 15: 102,116,907 probably benign Het
Stard13 C A 5: 151,190,011 L28F probably damaging Het
Susd2 C T 10: 75,638,019 A581T probably damaging Het
Taf2 A G 15: 55,059,939 V314A probably benign Het
Tas2r106 T C 6: 131,678,123 N255S possibly damaging Het
Tbxa2r T A 10: 81,332,941 W155R probably damaging Het
Tcf3 A G 10: 80,421,616 probably benign Het
Ticam1 TCACACA TCACA 17: 56,270,629 probably null Het
Vmn2r55 T C 7: 12,671,032 D148G probably damaging Het
Vmn2r77 A G 7: 86,812,027 N854D probably benign Het
Vstm4 A T 14: 32,904,569 H64L probably benign Het
Wdr92 A G 11: 17,224,638 T169A probably benign Het
Wnk2 T C 13: 49,102,800 T282A probably damaging Het
Zscan4c A T 7: 11,009,647 D391V probably benign Het
Other mutations in Etv4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Etv4 APN 11 101777128 missense possibly damaging 0.94
IGL02281:Etv4 APN 11 101773719 missense probably damaging 1.00
IGL02491:Etv4 APN 11 101783965 critical splice donor site probably null
IGL03221:Etv4 APN 11 101774162 missense probably damaging 1.00
R1539:Etv4 UTSW 11 101771687 critical splice donor site probably null
R1925:Etv4 UTSW 11 101771681 splice site probably benign
R2009:Etv4 UTSW 11 101774237 missense probably damaging 1.00
R2133:Etv4 UTSW 11 101775417 missense probably damaging 0.99
R4133:Etv4 UTSW 11 101770498 missense probably damaging 1.00
R5396:Etv4 UTSW 11 101775341 missense probably damaging 0.99
R5629:Etv4 UTSW 11 101771925 missense probably damaging 0.99
R7256:Etv4 UTSW 11 101784325 critical splice acceptor site probably null
Z1176:Etv4 UTSW 11 101770590 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCAAGTGCCACCATTTC -3'
(R):5'- TTCACTCCTGTCACATACTGGG -3'

Sequencing Primer
(F):5'- TCTCAGGGCTCCAAAGGTG -3'
(R):5'- CTGTCACATACTGGGTCCTGTAG -3'
Posted On2016-11-21