Incidental Mutation 'R5958:Ccin'
ID471274
Institutional Source Beutler Lab
Gene Symbol Ccin
Ensembl Gene ENSMUSG00000070999
Gene Namecalicin
Synonyms
MMRRC Submission 044145-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5958 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43983483-43985423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43983854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000092725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030202] [ENSMUST00000095107] [ENSMUST00000107855]
Predicted Effect probably benign
Transcript: ENSMUST00000030202
SMART Domains Protein: ENSMUSP00000030202
Gene: ENSMUSG00000028480

DomainStartEndE-ValueType
SCP 8 141 2.98e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095107
AA Change: D87G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092725
Gene: ENSMUSG00000070999
AA Change: D87G

DomainStartEndE-ValueType
BTB 28 128 1.55e-21 SMART
BACK 133 237 4.4e-7 SMART
Kelch 280 327 2.3e0 SMART
Kelch 328 375 2.39e-6 SMART
Kelch 376 423 2.56e0 SMART
Blast:Kelch 526 580 7e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107855
SMART Domains Protein: ENSMUSP00000103487
Gene: ENSMUSG00000028480

DomainStartEndE-ValueType
SCP 2 70 1.95e-3 SMART
Meta Mutation Damage Score 0.4481 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.0%
Validation Efficiency 95% (75/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a basic protein of the sperm head cytoskeleton. This protein contains kelch repeats and a BTB/POZ domain and is necessary for normal morphology during sperm differentiation. This gene is intronless. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,041,935 D616G probably damaging Het
Adam30 A G 3: 98,161,964 N243S probably damaging Het
Adck1 A G 12: 88,459,052 I417V probably benign Het
Adcy4 T C 14: 55,779,099 probably null Het
Ahctf1 A G 1: 179,746,542 probably benign Het
Ap1s3 G T 1: 79,614,243 T130K probably benign Het
Apold1 C T 6: 134,983,723 R47C probably damaging Het
Atp13a5 T C 16: 29,339,042 K197E probably damaging Het
Camk2d T G 3: 126,779,865 probably benign Het
Cdan1 T C 2: 120,723,902 T889A possibly damaging Het
Cel T A 2: 28,560,945 Y102F probably damaging Het
Cma1 A C 14: 55,941,656 *248E probably null Het
Cnbd1 T C 4: 18,862,056 N378S probably benign Het
Col18a1 T A 10: 77,096,397 Y533F probably benign Het
Cpb2 T C 14: 75,283,387 I414T probably damaging Het
D430042O09Rik A G 7: 125,813,635 K358E probably benign Het
Dagla T C 19: 10,248,424 Y792C probably damaging Het
Dlgap5 T A 14: 47,413,754 E107D probably damaging Het
Dmtf1 T A 5: 9,122,415 probably benign Het
Dst A G 1: 34,186,050 K1682R probably damaging Het
Epyc A T 10: 97,649,842 H48L probably benign Het
Fam135b A G 15: 71,462,895 S817P probably benign Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Foxk1 T C 5: 142,456,674 V693A probably benign Het
Fuom A T 7: 140,099,898 F122I probably damaging Het
Glg1 G T 8: 111,259,104 H31Q probably benign Het
Gm13199 C T 2: 5,862,254 probably benign Het
Hdac9 G T 12: 34,373,883 Q595K probably damaging Het
Homez C T 14: 54,856,841 R119Q probably benign Het
Ifit3b A G 19: 34,611,742 H106R probably benign Het
Ift57 C T 16: 49,711,108 probably benign Het
Itk A T 11: 46,344,855 probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhdc3 A T 17: 46,675,102 V378D probably benign Het
Klhl14 A G 18: 21,565,535 I407T probably damaging Het
Meioc A T 11: 102,675,153 T476S probably benign Het
Olfm3 G A 3: 115,122,306 V276I probably damaging Het
Olfr1449 T C 19: 12,935,047 F103S probably damaging Het
Pcm1 T C 8: 41,328,979 L1972P probably damaging Het
Pcsk6 A G 7: 66,043,611 E3G probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Pik3c2a A G 7: 116,362,564 L1010S probably damaging Het
Pitpnm3 G T 11: 72,112,367 probably null Het
Prrc2b A G 2: 32,212,080 M722V possibly damaging Het
Rad18 T C 6: 112,696,642 probably benign Het
Senp6 T C 9: 80,142,294 S1036P probably damaging Het
Slc22a22 C T 15: 57,263,536 A46T possibly damaging Het
Sox15 C T 11: 69,655,730 R120C probably damaging Het
Spag6l C A 16: 16,763,021 probably null Het
Strc T C 2: 121,376,922 H656R possibly damaging Het
Tanc2 A G 11: 105,840,625 D409G probably benign Het
Thap11 A G 8: 105,856,064 H235R probably damaging Het
Thsd7a T A 6: 12,337,262 Y1252F probably benign Het
Tlr11 T G 14: 50,360,777 N73K probably damaging Het
Ttll10 T C 4: 156,036,066 probably null Het
Ubr4 A T 4: 139,455,638 N445I probably damaging Het
Ugt1a6a C T 1: 88,215,788 probably benign Het
Urb2 T C 8: 124,029,659 F702L probably benign Het
Utp14b A T 1: 78,664,942 K186* probably null Het
Utp14b A T 1: 78,664,943 K186M probably damaging Het
Vmn2r16 T A 5: 109,362,287 M512K possibly damaging Het
Vmn2r27 T A 6: 124,231,727 M20L probably benign Het
Other mutations in Ccin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Ccin APN 4 43984069 missense probably damaging 1.00
IGL01688:Ccin APN 4 43984985 missense possibly damaging 0.95
R1017:Ccin UTSW 4 43985222 missense probably benign 0.05
R1707:Ccin UTSW 4 43983947 missense probably benign
R1709:Ccin UTSW 4 43984133 missense probably damaging 1.00
R4657:Ccin UTSW 4 43984981 missense probably damaging 1.00
R4954:Ccin UTSW 4 43985077 missense probably benign
R6034:Ccin UTSW 4 43985354 missense probably benign 0.00
R6034:Ccin UTSW 4 43985354 missense probably benign 0.00
R6768:Ccin UTSW 4 43984574 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAGTACTGGGACATGGCC -3'
(R):5'- GTTGTCACGAATGCCAGAGTAGG -3'

Sequencing Primer
(F):5'- CCTGACTGTGGACCATCATG -3'
(R):5'- CAGAGTAGGCCAAGTCTGATACTTC -3'
Posted On2017-03-31