Incidental Mutation 'R6077:Aldh1b1'
ID482782
Institutional Source Beutler Lab
Gene Symbol Aldh1b1
Ensembl Gene ENSMUSG00000035561
Gene Namealdehyde dehydrogenase 1 family, member B1
Synonyms
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6077 (G1)
Quality Score215.009
Status Not validated
Chromosome4
Chromosomal Location45799022-45804604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45802525 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 21 (Y21C)
Ref Sequence ENSEMBL: ENSMUSP00000134082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044384] [ENSMUST00000172750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044384
AA Change: Y21C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000041260
Gene: ENSMUSG00000035561
AA Change: Y21C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 510 1.5e-185 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172750
AA Change: Y21C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134082
Gene: ENSMUSG00000035561
AA Change: Y21C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 132 1.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fasting circulating glucose levels and decreased blood acetaldehyde clearance. Mice homozygous for a different knock-out allele display defects in beta cell development and functionality, and develop glucose intolerance, age-dependent hyperglycemia, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Aldh1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Aldh1b1 APN 4 45803472 missense possibly damaging 0.87
R0557:Aldh1b1 UTSW 4 45802647 missense probably benign 0.00
R1203:Aldh1b1 UTSW 4 45803359 missense probably damaging 1.00
R1807:Aldh1b1 UTSW 4 45802873 missense possibly damaging 0.69
R1939:Aldh1b1 UTSW 4 45802755 missense possibly damaging 0.53
R4722:Aldh1b1 UTSW 4 45803472 missense probably damaging 1.00
R4847:Aldh1b1 UTSW 4 45802625 missense possibly damaging 0.92
R4871:Aldh1b1 UTSW 4 45803383 missense probably benign 0.00
R4931:Aldh1b1 UTSW 4 45803661 missense probably benign 0.08
R4994:Aldh1b1 UTSW 4 45803128 missense possibly damaging 0.90
R5071:Aldh1b1 UTSW 4 45803383 unclassified probably null
R5216:Aldh1b1 UTSW 4 45803652 missense probably damaging 1.00
R5582:Aldh1b1 UTSW 4 45802750 missense probably damaging 1.00
R6640:Aldh1b1 UTSW 4 45803868 missense possibly damaging 0.92
R6692:Aldh1b1 UTSW 4 45803427 missense probably damaging 1.00
R7055:Aldh1b1 UTSW 4 45802909 missense possibly damaging 0.84
Z1088:Aldh1b1 UTSW 4 45802539 missense probably benign 0.06
Z1088:Aldh1b1 UTSW 4 45802540 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TGGATTTTGTACCCCACAACC -3'
(R):5'- AGATCAGCTAGGCGGTTCAG -3'

Sequencing Primer
(F):5'- ACAACCTATGCTTTTGGAGGC -3'
(R):5'- GCTCTGAGGCATCCATCCTG -3'
Posted On2017-07-14