Incidental Mutation 'R6091:Slc22a19'
ID485952
Institutional Source Beutler Lab
Gene Symbol Slc22a19
Ensembl Gene ENSMUSG00000024757
Gene Namesolute carrier family 22 (organic anion transporter), member 19
SynonymsOat5, D630043A20Rik, Slc22a9
MMRRC Submission 044248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6091 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7673061-7711310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7711063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 44 (I44T)
Ref Sequence ENSEMBL: ENSMUSP00000025666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025666]
Predicted Effect probably benign
Transcript: ENSMUST00000025666
AA Change: I44T

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025666
Gene: ENSMUSG00000024757
AA Change: I44T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sugar_tr 103 528 6.3e-22 PFAM
Pfam:MFS_1 122 378 2.4e-20 PFAM
Pfam:MFS_1 377 549 1.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141771
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A24 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T G 2: 35,362,336 T50P possibly damaging Het
Adad1 A G 3: 37,084,969 E396G possibly damaging Het
Adamtsl3 T A 7: 82,465,621 C232S probably damaging Het
AI606181 T C 19: 41,593,624 S78P unknown Het
Amph T A 13: 19,125,123 M457K probably benign Het
Ano1 A T 7: 144,669,434 M174K probably benign Het
C3 T A 17: 57,221,967 K632* probably null Het
Cep170 C T 1: 176,755,831 G994D probably damaging Het
Chd7 T C 4: 8,751,875 V124A probably damaging Het
Chd9 A G 8: 91,035,063 K2259E probably damaging Het
Col7a1 A G 9: 108,955,334 T137A unknown Het
Dcc C T 18: 71,809,114 V311I probably benign Het
Ddx42 A T 11: 106,234,970 Q282L probably damaging Het
Fcgbp A G 7: 28,104,965 T1833A possibly damaging Het
Fpr-rs3 A G 17: 20,624,270 I203T probably benign Het
Frem1 A G 4: 82,900,559 I2139T probably benign Het
Frmpd2 T C 14: 33,522,863 V546A probably damaging Het
Gbp11 G T 5: 105,331,388 T123N possibly damaging Het
Hs3st1 G A 5: 39,614,664 P212L probably damaging Het
Ifnb1 T A 4: 88,522,576 M67L probably benign Het
Ighv1-54 T C 12: 115,193,877 N50S probably benign Het
Ikzf4 G A 10: 128,634,673 T326I probably benign Het
Ints2 A T 11: 86,236,603 V501E probably damaging Het
Mfsd1 C A 3: 67,599,937 probably null Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mrps11 G A 7: 78,788,718 A73T possibly damaging Het
Mterf4 T C 1: 93,301,569 E311G probably damaging Het
Mx2 A G 16: 97,546,435 T176A probably damaging Het
Mycbp2 A C 14: 103,223,046 L1495R probably damaging Het
Myo3b A G 2: 70,238,769 T451A probably benign Het
Myrfl T C 10: 116,849,206 T90A probably benign Het
Nbeal1 A G 1: 60,181,556 probably benign Het
Ncor1 A G 11: 62,419,617 L201P probably damaging Het
Nfxl1 G T 5: 72,514,190 L909I probably benign Het
Nr3c1 GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC 18: 39,486,958 probably benign Het
Olfr1107 T A 2: 87,071,361 S258C probably benign Het
Plscr5 A G 9: 92,204,384 T136A probably benign Het
Ppp1r3a G A 6: 14,719,340 T525I probably benign Het
Ptprg G A 14: 12,215,979 G1143R probably damaging Het
Rbm47 G C 5: 66,026,283 R326G probably damaging Het
Ryr1 T C 7: 29,071,973 T2541A probably benign Het
Sall1 A G 8: 89,028,619 L1244P probably damaging Het
Sec16a G A 2: 26,426,470 H1673Y probably damaging Het
Snap91 T A 9: 86,839,628 N53Y probably damaging Het
Sorcs1 T C 19: 50,288,101 T338A possibly damaging Het
Taf6l T C 19: 8,778,556 T243A probably benign Het
Tex10 T C 4: 48,459,891 R487G probably damaging Het
Tfcp2 G T 15: 100,512,313 T391N probably damaging Het
Tnxb G A 17: 34,710,364 V2794M probably damaging Het
Ush2a T G 1: 188,399,803 C741G probably damaging Het
Vmn1r3 T A 4: 3,184,684 I208F probably damaging Het
Vmn2r28 T A 7: 5,493,791 I21F possibly damaging Het
Vmn2r93 A G 17: 18,325,696 D610G probably benign Het
Wbp1 T C 6: 83,119,487 S229G probably benign Het
Xirp1 A G 9: 120,017,963 V618A probably benign Het
Zbtb32 A G 7: 30,591,829 S14P possibly damaging Het
Zfp24 A G 18: 24,014,212 S348P probably damaging Het
Other mutations in Slc22a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:Slc22a19 APN 19 7682958 missense probably benign 0.00
IGL01126:Slc22a19 APN 19 7674283 missense possibly damaging 0.65
IGL01349:Slc22a19 APN 19 7674427 missense probably benign 0.36
IGL01409:Slc22a19 APN 19 7711130 missense probably benign 0.00
IGL01529:Slc22a19 APN 19 7682935 missense probably damaging 0.97
IGL03382:Slc22a19 APN 19 7681862 missense probably benign 0.01
R0269:Slc22a19 UTSW 19 7709621 splice site probably benign
R0464:Slc22a19 UTSW 19 7682913 missense probably benign 0.44
R1866:Slc22a19 UTSW 19 7711141 missense probably damaging 1.00
R1975:Slc22a19 UTSW 19 7683859 splice site probably benign
R2184:Slc22a19 UTSW 19 7709661 missense probably benign
R2226:Slc22a19 UTSW 19 7683850 missense possibly damaging 0.92
R2894:Slc22a19 UTSW 19 7692804 missense probably benign 0.43
R4751:Slc22a19 UTSW 19 7691145 missense possibly damaging 0.65
R5016:Slc22a19 UTSW 19 7674372 missense probably benign 0.07
R5026:Slc22a19 UTSW 19 7674372 missense probably benign 0.07
R5108:Slc22a19 UTSW 19 7711171 missense probably benign
R5149:Slc22a19 UTSW 19 7711138 missense probably damaging 1.00
R5714:Slc22a19 UTSW 19 7711022 missense probably damaging 0.98
R6062:Slc22a19 UTSW 19 7674282 missense probably damaging 1.00
R6982:Slc22a19 UTSW 19 7682969 missense probably benign 0.08
R7624:Slc22a19 UTSW 19 7673303 nonsense probably null
R7624:Slc22a19 UTSW 19 7693818 missense probably benign 0.44
R7678:Slc22a19 UTSW 19 7710937 missense possibly damaging 0.88
R7743:Slc22a19 UTSW 19 7683836 missense possibly damaging 0.74
R7770:Slc22a19 UTSW 19 7703995 splice site probably null
R8769:Slc22a19 UTSW 19 7692721 missense possibly damaging 0.89
R8861:Slc22a19 UTSW 19 7682959 missense possibly damaging 0.55
X0026:Slc22a19 UTSW 19 7710858 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAAGGAGATGCCACTGTG -3'
(R):5'- GGCAGTCAGCTCCTTACCTAAC -3'

Sequencing Primer
(F):5'- CCACTGTGGTTGAATATAGCGAC -3'
(R):5'- GGGACCCATTAAGAACAGCTCTG -3'
Posted On2017-08-16