Incidental Mutation 'R5867:Alad'
ID490490
Institutional Source Beutler Lab
Gene Symbol Alad
Ensembl Gene ENSMUSG00000028393
Gene Nameaminolevulinate, delta-, dehydratase
SynonymsLv
MMRRC Submission 043233-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R5867 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location62509169-62519918 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62512966 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 56 (Y56N)
Ref Sequence ENSEMBL: ENSMUSP00000103068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030090] [ENSMUST00000107444]
Predicted Effect probably damaging
Transcript: ENSMUST00000030090
AA Change: Y56N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030090
Gene: ENSMUSG00000028393
AA Change: Y56N

DomainStartEndE-ValueType
ALAD 2 327 1.56e-185 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107444
AA Change: Y56N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103068
Gene: ENSMUSG00000028393
AA Change: Y56N

DomainStartEndE-ValueType
ALAD 2 327 1.56e-185 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137448
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ALAD enzyme is composed of 8 identical subunits and catalyzes the condensation of 2 molecules of delta-aminolevulinate to form porphobilinogen (a precursor of heme, cytochromes and other hemoproteins). ALAD catalyzes the second step in the porphyrin and heme biosynthetic pathway; zinc is essential for enzymatic activity. ALAD enzymatic activity is inhibited by lead and a defect in the ALAD structural gene can cause increased sensitivity to lead poisoning and acute hepatic porphyria. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,052 V2900A probably damaging Het
Akip1 A G 7: 109,707,477 H127R probably benign Het
Aldoart1 T A 4: 72,852,533 M13L probably benign Het
Ap1g1 C T 8: 109,818,982 A89V probably damaging Het
Ascc3 C T 10: 50,842,183 R1991* probably null Het
Cd209b T C 8: 3,924,246 I89V possibly damaging Het
Cd36 T C 5: 17,785,735 K469R probably benign Het
Cdh7 T A 1: 110,048,851 I82N probably damaging Het
Clmn G T 12: 104,781,755 P511H probably damaging Het
Cyfip1 A C 7: 55,926,313 D1077A probably damaging Het
Cyp2a5 T C 7: 26,842,958 F462L probably benign Het
Dclk2 A G 3: 86,791,859 *709Q probably null Het
Drd1 T C 13: 54,054,163 T4A probably benign Het
Ephb2 C T 4: 136,675,422 V513I possibly damaging Het
Fam43a T A 16: 30,601,459 V287E probably benign Het
Gm5134 A G 10: 76,008,616 E602G probably benign Het
Gtsf2 C T 15: 103,439,636 G149E probably benign Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klhl6 T C 16: 19,982,820 T62A probably benign Het
Lamb1 T A 12: 31,298,955 I662N possibly damaging Het
Lmod3 A G 6: 97,248,002 V286A probably damaging Het
Mefv T C 16: 3,715,933 D158G probably damaging Het
Mff T C 1: 82,750,606 probably null Het
Mfsd6l G T 11: 68,557,210 V296L possibly damaging Het
Neu2 G T 1: 87,596,756 Q154H probably damaging Het
Olfr1033 A G 2: 86,041,451 I45M probably benign Het
Pdk4 T A 6: 5,487,452 H266L probably benign Het
Pdrg1 T C 2: 153,014,055 N40D probably damaging Het
Pi4k2a T C 19: 42,105,485 probably null Het
Pkd1l2 T A 8: 117,055,011 D765V probably damaging Het
Pspc1 A T 14: 56,762,041 probably null Het
Ptprm T C 17: 67,045,981 probably null Het
Spata31d1d T C 13: 59,727,240 K827R possibly damaging Het
Srebf2 T A 15: 82,169,786 F46Y probably damaging Het
Tfrc T A 16: 32,620,412 C365S possibly damaging Het
Ttc7 A G 17: 87,322,472 H294R possibly damaging Het
Ubr7 T A 12: 102,761,494 Y92N probably damaging Het
Vmn1r42 A C 6: 89,844,779 Y269* probably null Het
Vmn2r1 A G 3: 64,104,569 E617G probably benign Het
Vps13c A G 9: 67,982,622 probably null Het
Vps50 T C 6: 3,536,965 L312P probably damaging Het
Wdr82 A G 9: 106,185,304 Q252R probably benign Het
Zcchc3 A G 2: 152,414,524 F85S probably damaging Het
Zfhx3 T C 8: 108,793,446 L400P probably damaging Het
Other mutations in Alad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Alad APN 4 62514093 missense probably benign 0.00
IGL03358:Alad APN 4 62510607 splice site probably benign
R5905:Alad UTSW 4 62510122 missense probably benign 0.06
R6028:Alad UTSW 4 62510122 missense probably benign 0.06
R7554:Alad UTSW 4 62511786 critical splice acceptor site probably null
R8015:Alad UTSW 4 62511922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTGAGAGCGTGCACTG -3'
(R):5'- CGTTTTGCTGAGGAGCTCTC -3'

Sequencing Primer
(F):5'- AGACCATGCTGGCTTTGAAC -3'
(R):5'- TGAGGAGCTCTCACATGCTAG -3'
Posted On2017-10-20