Incidental Mutation 'R0536:AW209491'
ID49467
Institutional Source Beutler Lab
Gene Symbol AW209491
Ensembl Gene ENSMUSG00000039182
Gene Nameexpressed sequence AW209491
Synonyms
MMRRC Submission 038728-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R0536 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14630154-14639096 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14636973 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 137 (Y137C)
Ref Sequence ENSEMBL: ENSMUSP00000136376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038690] [ENSMUST00000178289] [ENSMUST00000221168] [ENSMUST00000222052]
Predicted Effect probably damaging
Transcript: ENSMUST00000038690
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041523
Gene: ENSMUSG00000039182
AA Change: Y137C

DomainStartEndE-ValueType
Pfam:DUF1308 38 401 2.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178289
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136376
Gene: ENSMUSG00000039182
AA Change: Y137C

DomainStartEndE-ValueType
Pfam:DUF1308 37 401 1.1e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221168
Predicted Effect probably benign
Transcript: ENSMUST00000222052
Meta Mutation Damage Score 0.8475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (29/29)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,280,516 probably benign Het
Agrn A T 4: 156,179,553 D84E probably benign Het
Akap11 A G 14: 78,514,024 S308P probably damaging Het
Atp6v1c2 A T 12: 17,307,508 probably null Het
Chst9 G A 18: 15,495,330 probably benign Het
Dok7 A G 5: 35,066,482 T122A probably damaging Het
Hoxb5 T C 11: 96,304,028 S139P possibly damaging Het
Ikzf4 T A 10: 128,641,249 E64D probably benign Het
Kif21a C A 15: 90,959,683 probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lama3 C T 18: 12,525,894 R2036C probably damaging Het
Lrba T A 3: 86,715,532 V311D probably damaging Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mylk T C 16: 35,000,387 V1903A possibly damaging Het
Naa30 C T 14: 49,173,077 A154V possibly damaging Het
Olfr617 T C 7: 103,584,261 S80P probably damaging Het
Olfr705 T A 7: 106,714,321 Y120F probably damaging Het
Olfr938 G T 9: 39,078,329 Q139K probably benign Het
Pgm3 C T 9: 86,567,536 V144M possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rgsl1 T A 1: 153,826,181 S211C probably damaging Het
Setx T C 2: 29,158,248 Y1954H possibly damaging Het
Sorcs3 C T 19: 48,802,698 Q1162* probably null Het
Sptbn2 T A 19: 4,726,690 D255E probably damaging Het
Ttc39b T C 4: 83,227,198 E597G probably damaging Het
Vldlr G A 19: 27,239,964 A436T probably damaging Het
Wdr72 G A 9: 74,157,408 G574D probably damaging Het
Zzz3 T G 3: 152,448,828 I572S probably damaging Het
Other mutations in AW209491
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:AW209491 APN 13 14637075 missense probably damaging 0.98
IGL02634:AW209491 APN 13 14637683 missense probably damaging 0.99
IGL02635:AW209491 APN 13 14637267 missense possibly damaging 0.46
IGL03401:AW209491 APN 13 14637456 missense probably benign
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0067:AW209491 UTSW 13 14637743 missense probably benign 0.24
R0539:AW209491 UTSW 13 14637732 missense probably damaging 1.00
R0845:AW209491 UTSW 13 14637022 missense probably damaging 1.00
R1851:AW209491 UTSW 13 14636733 missense possibly damaging 0.73
R4110:AW209491 UTSW 13 14637573 missense probably damaging 1.00
R4379:AW209491 UTSW 13 14637827 makesense probably null
R5153:AW209491 UTSW 13 14637179 missense probably benign
R5987:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5988:AW209491 UTSW 13 14637780 missense probably benign 0.00
R5990:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6019:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6021:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6022:AW209491 UTSW 13 14637780 missense probably benign 0.00
R6160:AW209491 UTSW 13 14636721 missense probably damaging 0.99
R6179:AW209491 UTSW 13 14637083 missense possibly damaging 0.92
R6194:AW209491 UTSW 13 14637120 missense possibly damaging 0.89
R7594:AW209491 UTSW 13 14637246 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCCATCGTGGAATCGGCAG -3'
(R):5'- CAGAAGTTCTTGGCCCTCGTCATC -3'

Sequencing Primer
(F):5'- TCGTGGAATCGGCAGAGAAC -3'
(R):5'- AGAGTTGACGGCTACAATGTCTC -3'
Posted On2013-06-12