Incidental Mutation 'R2870:Dcp1b'
ID500424
Institutional Source Beutler Lab
Gene Symbol Dcp1b
Ensembl Gene ENSMUSG00000041477
Gene Namedecapping mRNA 1B
SynonymsB930050E02Rik
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location119175253-119221616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119214774 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 217 (S217L)
Ref Sequence ENSEMBL: ENSMUSP00000108397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073909] [ENSMUST00000112777]
Predicted Effect probably benign
Transcript: ENSMUST00000073909
AA Change: S217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073568
Gene: ENSMUSG00000041477
AA Change: S217L

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 10 131 1.3e-53 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112777
AA Change: S217L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108397
Gene: ENSMUSG00000041477
AA Change: S217L

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 13 129 3e-46 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:mRNA_decap_C 536 578 2.1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149651
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 94.1%
  • 20x: 79.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mmp1b A T 9: 7,386,875 silent Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Dcp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Dcp1b APN 6 119215358 missense probably damaging 0.96
IGL01320:Dcp1b APN 6 119215075 missense probably benign 0.29
IGL01348:Dcp1b APN 6 119183718 missense probably damaging 1.00
IGL01635:Dcp1b APN 6 119206537 missense probably damaging 1.00
IGL02888:Dcp1b APN 6 119220087 utr 3 prime probably benign
IGL03280:Dcp1b APN 6 119180058 intron probably benign
R1672:Dcp1b UTSW 6 119217911 missense probably benign
R2395:Dcp1b UTSW 6 119215064 missense probably benign
R2421:Dcp1b UTSW 6 119215266 missense probably benign 0.28
R2512:Dcp1b UTSW 6 119206512 missense possibly damaging 0.69
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R4450:Dcp1b UTSW 6 119206476 missense probably benign 0.01
R5394:Dcp1b UTSW 6 119175367 missense probably damaging 1.00
R5688:Dcp1b UTSW 6 119217911 missense probably benign
R7734:Dcp1b UTSW 6 119215283 missense probably benign 0.00
R7752:Dcp1b UTSW 6 119175357 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACACTTCAAAGGTCTCAGGC -3'
(R):5'- CATGAGTTTCTGAATGGCCGG -3'

Sequencing Primer
(F):5'- AAGGTCTCAGGCTTTCCAAG -3'
(R):5'- TTCTGAATGGCCGGGCAGAG -3'
Posted On2017-12-01