Incidental Mutation 'R7734:Dcp1b'
ID596047
Institutional Source Beutler Lab
Gene Symbol Dcp1b
Ensembl Gene ENSMUSG00000041477
Gene Namedecapping mRNA 1B
SynonymsB930050E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location119175253-119221616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119215283 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 387 (S387G)
Ref Sequence ENSEMBL: ENSMUSP00000108397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073909] [ENSMUST00000112777]
Predicted Effect probably benign
Transcript: ENSMUST00000073909
AA Change: S387G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073568
Gene: ENSMUSG00000041477
AA Change: S387G

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 10 131 1.3e-53 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112777
AA Change: S387G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108397
Gene: ENSMUSG00000041477
AA Change: S387G

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
Pfam:DCP1 13 129 3e-46 PFAM
low complexity region 250 260 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 515 526 N/A INTRINSIC
Pfam:mRNA_decap_C 536 578 2.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Dcp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Dcp1b APN 6 119215358 missense probably damaging 0.96
IGL01320:Dcp1b APN 6 119215075 missense probably benign 0.29
IGL01348:Dcp1b APN 6 119183718 missense probably damaging 1.00
IGL01635:Dcp1b APN 6 119206537 missense probably damaging 1.00
IGL02888:Dcp1b APN 6 119220087 utr 3 prime probably benign
IGL03280:Dcp1b APN 6 119180058 intron probably benign
R1672:Dcp1b UTSW 6 119217911 missense probably benign
R2395:Dcp1b UTSW 6 119215064 missense probably benign
R2421:Dcp1b UTSW 6 119215266 missense probably benign 0.28
R2512:Dcp1b UTSW 6 119206512 missense possibly damaging 0.69
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R2870:Dcp1b UTSW 6 119214774 missense probably benign
R4450:Dcp1b UTSW 6 119206476 missense probably benign 0.01
R5394:Dcp1b UTSW 6 119175367 missense probably damaging 1.00
R5688:Dcp1b UTSW 6 119217911 missense probably benign
R7752:Dcp1b UTSW 6 119175357 missense possibly damaging 0.64
R7847:Dcp1b UTSW 6 119215295 missense probably benign
R8274:Dcp1b UTSW 6 119183651 missense probably damaging 1.00
R8325:Dcp1b UTSW 6 119215436 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTCCTGCAAAAGTGGCAG -3'
(R):5'- GTACTACCTGGAGCTTCCTTAG -3'

Sequencing Primer
(F):5'- AAAGTGGCAGCCCCAGTC -3'
(R):5'- CTCCTTCCTGAGAGCTTG -3'
Posted On2019-11-12