Incidental Mutation 'R6185:Slc5a2'
ID502108
Institutional Source Beutler Lab
Gene Symbol Slc5a2
Ensembl Gene ENSMUSG00000030781
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 2
SynonymsSglt2
MMRRC Submission 044325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6185 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128265657-128272430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128271177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 529 (I529T)
Ref Sequence ENSEMBL: ENSMUSP00000112597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033044] [ENSMUST00000033045] [ENSMUST00000118169] [ENSMUST00000126263] [ENSMUST00000137038] [ENSMUST00000142841] [ENSMUST00000153418] [ENSMUST00000205720] [ENSMUST00000206909]
Predicted Effect probably benign
Transcript: ENSMUST00000033044
SMART Domains Protein: ENSMUSP00000033044
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 62 301 5.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033045
Predicted Effect probably damaging
Transcript: ENSMUST00000118169
AA Change: I529T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112597
Gene: ENSMUSG00000030781
AA Change: I529T

DomainStartEndE-ValueType
Pfam:SSF 53 490 7e-170 PFAM
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 566 577 N/A INTRINSIC
low complexity region 615 635 N/A INTRINSIC
transmembrane domain 650 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126263
SMART Domains Protein: ENSMUSP00000114673
Gene: ENSMUSG00000030780

DomainStartEndE-ValueType
Pfam:DUF647 61 304 3e-102 PFAM
low complexity region 334 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136345
Predicted Effect probably benign
Transcript: ENSMUST00000137038
SMART Domains Protein: ENSMUSP00000124318
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 1 103 3.3e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139452
Predicted Effect probably benign
Transcript: ENSMUST00000142841
SMART Domains Protein: ENSMUSP00000115451
Gene: ENSMUSG00000030781

DomainStartEndE-ValueType
Pfam:SSF 53 276 5.7e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147091
Predicted Effect probably benign
Transcript: ENSMUST00000153418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155177
Predicted Effect silent
Transcript: ENSMUST00000205720
Predicted Effect silent
Transcript: ENSMUST00000206703
Predicted Effect probably benign
Transcript: ENSMUST00000206909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171335
Predicted Effect probably benign
Transcript: ENSMUST00000206716
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium glucose cotransporter family which are sodium-dependent glucose transport proteins. The encoded protein is the major cotransporter involved in glucose reabsorption in the kidney. Mutations in this gene are associated with renal glucosuria. Two transcript variants, one protein-coding and one not, have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit increased urine glucose, increased eating and drinking behaviors, increased circulating renin activity, decreased urine osmolality, decreased serum aldosterone levels, polyuria, and decreased glucose renal reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,089 H894Q probably benign Het
Abca4 A T 3: 122,126,140 I1024F probably damaging Het
Acadl A G 1: 66,838,363 V343A possibly damaging Het
Akr1e1 T A 13: 4,601,253 I123L probably benign Het
Angptl2 T C 2: 33,229,014 S267P probably benign Het
Ap2a1 T G 7: 44,916,170 K91T probably damaging Het
Bend7 A T 2: 4,788,522 Q379L probably damaging Het
Bicdl1 C T 5: 115,670,153 probably null Het
Cachd1 C A 4: 100,981,031 Y830* probably null Het
Ccdc158 T A 5: 92,666,854 I38F possibly damaging Het
Cep97 T A 16: 55,915,092 M448L probably benign Het
Chd9 A G 8: 91,049,137 D2572G probably damaging Het
Clcnkb C T 4: 141,414,514 V54M probably benign Het
Cln8 A G 8: 14,896,544 D186G probably benign Het
Crxos C T 7: 15,902,880 S22L possibly damaging Het
Cx3cr1 A T 9: 120,051,378 H319Q probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Dmrta1 A G 4: 89,691,768 R322G probably damaging Het
Dpf1 A G 7: 29,311,271 E103G possibly damaging Het
Dsg1b T G 18: 20,399,486 V529G probably benign Het
Dst G A 1: 34,173,080 V1361I probably damaging Het
Epha4 T C 1: 77,507,106 I89V probably damaging Het
Etfdh G T 3: 79,605,807 H370N probably benign Het
Fam186a A G 15: 99,947,649 I238T unknown Het
Fbxl5 T A 5: 43,821,552 S19C probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fryl A G 5: 73,112,788 V367A probably benign Het
Gm19410 T A 8: 35,807,510 L1495H possibly damaging Het
Gm19965 A G 1: 116,821,273 E228G possibly damaging Het
Gpr89 C A 3: 96,890,833 C169F probably damaging Het
Hmcn1 A T 1: 150,615,438 probably null Het
Hsph1 A T 5: 149,617,695 C753S probably damaging Het
Igf2 T A 7: 142,658,381 S4C possibly damaging Het
Kansl3 A T 1: 36,346,018 S486T probably damaging Het
Khdrbs1 G C 4: 129,742,275 probably benign Het
Lnx1 A T 5: 74,685,608 C60* probably null Het
Lrpprc T C 17: 84,767,024 D485G probably benign Het
Ly6i A T 15: 74,980,030 S97T possibly damaging Het
Me2 G A 18: 73,791,128 Q338* probably null Het
Med16 A T 10: 79,896,363 L790Q probably damaging Het
Muc16 G T 9: 18,654,473 T2250K unknown Het
Myo10 T G 15: 25,726,510 F273C probably damaging Het
Neil3 T A 8: 53,599,147 H472L probably benign Het
Nrxn1 T A 17: 90,037,136 S57C probably damaging Het
Nup188 A T 2: 30,341,710 T1439S probably damaging Het
Olfr1128 A G 2: 87,544,743 M267T possibly damaging Het
Olfr1512 T C 14: 52,372,562 T164A possibly damaging Het
Olfr978 T C 9: 39,994,124 F105L probably benign Het
Otud7a T A 7: 63,758,385 L812Q probably damaging Het
Paip2b C T 6: 83,809,970 A95T probably benign Het
Pax4 C T 6: 28,446,348 V49I probably damaging Het
Plek C T 11: 16,981,829 A341T probably damaging Het
Prkag1 G A 15: 98,825,714 P10L probably benign Het
R3hdm1 A C 1: 128,151,861 D15A possibly damaging Het
Rad54b A T 4: 11,593,804 D144V possibly damaging Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Sbf1 A G 15: 89,305,611 L379P probably damaging Het
Sec14l3 A T 11: 4,075,244 I285F probably damaging Het
Sec31b A T 19: 44,543,284 I62N possibly damaging Het
Selp A G 1: 164,126,346 N72D probably damaging Het
Sipa1l1 T A 12: 82,425,028 S1261T probably damaging Het
Sipa1l2 A T 8: 125,468,253 Y915* probably null Het
Slc22a27 A T 19: 7,926,588 D61E probably benign Het
Slc2a7 A G 4: 150,148,993 T8A probably benign Het
Spg20 A C 3: 55,117,219 Q78H probably damaging Het
Spocd1 T C 4: 129,956,449 I756T probably benign Het
Stc1 G A 14: 69,038,364 C202Y probably damaging Het
Stk10 A G 11: 32,577,749 T166A probably benign Het
Syt6 A T 3: 103,585,528 D32V probably damaging Het
Tanc1 T A 2: 59,791,585 probably null Het
Tanc2 T A 11: 105,913,039 N297K probably damaging Het
Telo2 A G 17: 25,102,040 S734P probably benign Het
Tfrc T A 16: 32,618,272 Y250N probably benign Het
Tmem97 C T 11: 78,543,562 W65* probably null Het
Ubr3 T C 2: 69,938,277 M476T probably damaging Het
Ubtf T C 11: 102,314,023 T117A probably damaging Het
Usp17lb T A 7: 104,841,424 M99L probably benign Het
Uvrag A C 7: 99,140,832 probably null Het
Vmn2r63 A G 7: 42,929,011 S153P probably damaging Het
Vmn2r90 A T 17: 17,733,382 T603S probably damaging Het
Vps8 C A 16: 21,470,141 L417I probably damaging Het
Other mutations in Slc5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Slc5a2 APN 7 128270622 missense probably benign 0.07
IGL03084:Slc5a2 APN 7 128266604 missense probably benign 0.25
dregs UTSW 7 128267505 splice site probably null
jimbee UTSW 7 large deletion
R0026:Slc5a2 UTSW 7 128270053 missense probably damaging 1.00
R0395:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0544:Slc5a2 UTSW 7 128269999 missense probably damaging 1.00
R0762:Slc5a2 UTSW 7 128267482 missense probably damaging 1.00
R0966:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R0968:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1382:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1383:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1385:Slc5a2 UTSW 7 128270631 missense probably damaging 1.00
R1467:Slc5a2 UTSW 7 128271256 unclassified probably benign
R4836:Slc5a2 UTSW 7 128267505 splice site probably null
R4983:Slc5a2 UTSW 7 128271810 makesense probably null
R5703:Slc5a2 UTSW 7 128270615 missense possibly damaging 0.77
R6696:Slc5a2 UTSW 7 128270043 missense probably damaging 1.00
R6969:Slc5a2 UTSW 7 128272077 missense probably benign 0.00
R7062:Slc5a2 UTSW 7 128270040 missense probably damaging 0.99
R7576:Slc5a2 UTSW 7 128265805 missense probably damaging 1.00
R7747:Slc5a2 UTSW 7 128266395 splice site probably null
R7802:Slc5a2 UTSW 7 128271798 missense possibly damaging 0.80
R7915:Slc5a2 UTSW 7 128265794 missense probably damaging 0.96
R8027:Slc5a2 UTSW 7 128270546 missense probably damaging 1.00
R8194:Slc5a2 UTSW 7 128271156 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGAACTTGAACTCCGGGTG -3'
(R):5'- TTCATACTGCAGGCCTCTGG -3'

Sequencing Primer
(F):5'- TTGGGCAGCTTGAGTAGGCTAAC -3'
(R):5'- GCCTCTGTGGGCGTTCC -3'
Posted On2018-02-27