Incidental Mutation 'R6229:Myrf'
ID504593
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 044358-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R6229 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10219798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 462 (V462A)
Ref Sequence ENSEMBL: ENSMUSP00000139601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably benign
Transcript: ENSMUST00000088013
AA Change: V462A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: V462A

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186056
AA Change: V260A

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: V260A

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186854
Predicted Effect probably benign
Transcript: ENSMUST00000189897
AA Change: V462A

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: V462A

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G A 1: 120,171,483 probably null Het
Adamts6 G A 13: 104,347,392 probably null Het
Add3 C A 19: 53,234,846 A343D probably benign Het
Ankub1 T C 3: 57,665,107 D398G probably benign Het
Apbb1 C T 7: 105,573,730 A225T probably damaging Het
Apbb1 C A 7: 105,573,731 W224C probably damaging Het
Arhgef40 A T 14: 51,990,090 Q431L probably benign Het
Calm4 A G 13: 3,838,038 D48G possibly damaging Het
Ccdc18 A T 5: 108,171,618 I502L probably benign Het
Cftr T C 6: 18,220,684 S185P probably damaging Het
Chd2 C A 7: 73,451,723 K1418N possibly damaging Het
Cmya5 A C 13: 93,093,306 V1758G probably benign Het
Cpsf4l T C 11: 113,708,854 K35R possibly damaging Het
Cyp2c68 A T 19: 39,739,178 V119E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnah3 G T 7: 119,965,488 Q2651K probably benign Het
Eif4g2 T C 7: 111,077,713 probably null Het
Enc1 A G 13: 97,245,491 R170G probably benign Het
Enpp2 T C 15: 54,877,832 R357G probably damaging Het
Epb41l2 A G 10: 25,499,836 K58E possibly damaging Het
Fis1 A G 5: 136,965,674 probably null Het
Fmo9 A C 1: 166,677,557 M89R possibly damaging Het
Gm13119 T C 4: 144,363,629 M413T probably benign Het
Gm6096 A C 7: 34,251,251 I72L possibly damaging Het
Golga5 G A 12: 102,484,481 M464I probably benign Het
Got1l1 T C 8: 27,198,436 probably null Het
Igfbpl1 A G 4: 45,813,517 Y233H probably damaging Het
Il18r1 T C 1: 40,474,763 I43T probably benign Het
Ints8 T C 4: 11,252,891 N64D probably damaging Het
Kalrn A G 16: 34,055,071 S44P probably damaging Het
Kif13b G T 14: 64,738,567 G444W probably damaging Het
Lmo1 A G 7: 109,143,625 C13R probably damaging Het
Lrfn2 T A 17: 49,097,132 M761K possibly damaging Het
Lrrd1 T C 5: 3,863,887 I719T probably damaging Het
Madd A T 2: 91,143,670 V1423E probably damaging Het
Mbnl1 T A 3: 60,621,328 probably null Het
Mrps28 T C 3: 8,900,037 D114G probably damaging Het
Muc6 T A 7: 141,640,525 M1412L probably benign Het
Myf6 T C 10: 107,494,419 K96E possibly damaging Het
Nbeal1 T C 1: 60,248,365 S923P possibly damaging Het
Nckap1l T C 15: 103,473,122 L430P possibly damaging Het
Nfatc2ip C T 7: 126,395,941 probably null Het
Olfr1145 G T 2: 87,810,087 C89F probably damaging Het
Olfr1362 T C 13: 21,611,649 I107V probably benign Het
Olfr739 A G 14: 50,425,205 R229G probably benign Het
Olfr853 T A 9: 19,537,718 I71F possibly damaging Het
Plin2 A G 4: 86,668,666 V5A probably benign Het
Ptprm T A 17: 66,688,300 D1311V probably damaging Het
Recql5 A T 11: 115,930,714 I72N probably damaging Het
Sall2 A T 14: 52,313,191 M847K probably benign Het
Slc23a1 T C 18: 35,619,524 R567G probably benign Het
Slc28a1 G A 7: 81,125,005 R200H probably benign Het
Smc4 T A 3: 69,030,247 Y843* probably null Het
Syne2 C A 12: 75,921,220 Q915K probably benign Het
Tas2r131 T A 6: 132,957,022 I275F probably damaging Het
Tcf20 T C 15: 82,854,880 H790R probably damaging Het
Tm7sf3 A G 6: 146,613,389 F310S possibly damaging Het
Tmem9b T A 7: 109,745,420 probably null Het
Tnfaip8 A G 18: 50,051,675 probably benign Het
Top2b T G 14: 16,409,838 L835R probably damaging Het
Trappc8 A T 18: 20,870,745 S209T probably benign Het
Ttc26 T A 6: 38,395,040 N188K probably benign Het
Uap1 C T 1: 170,166,733 R58Q probably benign Het
Upk3bl A G 5: 136,064,061 probably null Het
Usp34 A G 11: 23,446,778 H596R probably damaging Het
Vmn1r181 C T 7: 23,984,155 A15V probably damaging Het
Vmn2r54 T A 7: 12,631,956 K350N probably benign Het
Vmn2r89 A G 14: 51,455,721 H176R probably benign Het
Vwa7 A G 17: 35,024,265 R640G probably benign Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1801:Myrf UTSW 19 10214191 missense probably benign 0.03
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
R7162:Myrf UTSW 19 10218646 missense possibly damaging 0.75
R7553:Myrf UTSW 19 10228876 missense probably benign
R7585:Myrf UTSW 19 10216727 missense probably damaging 1.00
R7838:Myrf UTSW 19 10219619 missense possibly damaging 0.55
R7921:Myrf UTSW 19 10219619 missense possibly damaging 0.55
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Z1177:Myrf UTSW 19 10219544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACCCTACAGAGAATGGGC -3'
(R):5'- CCCATGAGTTTGTGAGGAAGTG -3'

Sequencing Primer
(F):5'- CCCTACAGAGAATGGGCAGAGG -3'
(R):5'- CCCCATGAGTTTGTGAAGAAGTG -3'
Posted On2018-02-28