Incidental Mutation 'R6236:Zfp712'
ID504958
Institutional Source Beutler Lab
Gene Symbol Zfp712
Ensembl Gene ENSMUSG00000090641
Gene Namezinc finger protein 712
Synonyms4921504N20Rik, mszf31, mszf89
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6236 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67038596-67061170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67040621 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 614 (C614Y)
Ref Sequence ENSEMBL: ENSMUSP00000126665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167565]
Predicted Effect probably damaging
Transcript: ENSMUST00000167565
AA Change: C614Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126665
Gene: ENSMUSG00000090641
AA Change: C614Y

DomainStartEndE-ValueType
KRAB 5 65 7.38e-36 SMART
ZnF_C2H2 109 131 1.28e-3 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 186 1.73e0 SMART
ZnF_C2H2 192 214 3.39e-3 SMART
ZnF_C2H2 220 242 1.58e-3 SMART
ZnF_C2H2 248 270 8.34e-3 SMART
ZnF_C2H2 276 298 4.17e-3 SMART
ZnF_C2H2 304 326 4.87e-4 SMART
ZnF_C2H2 332 354 1.04e-3 SMART
ZnF_C2H2 360 382 5.5e-3 SMART
ZnF_C2H2 388 410 1.89e-1 SMART
ZnF_C2H2 416 438 7.15e-2 SMART
ZnF_C2H2 444 466 3.58e-2 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 2.12e-4 SMART
ZnF_C2H2 528 550 3.83e-2 SMART
ZnF_C2H2 556 578 2.95e-3 SMART
ZnF_C2H2 584 606 6.32e-3 SMART
ZnF_C2H2 612 634 3.89e-3 SMART
ZnF_C2H2 640 662 3.49e-5 SMART
ZnF_C2H2 668 690 1.84e-4 SMART
Meta Mutation Damage Score 0.4470 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 A G 4: 155,905,207 T703A possibly damaging Het
Acd C T 8: 105,700,495 A49T probably benign Het
Acer1 T A 17: 56,955,231 I224F probably benign Het
Acvr1 T C 2: 58,477,666 D161G probably benign Het
Catsper4 T C 4: 134,221,576 I111V probably benign Het
Ccdc173 A C 2: 69,758,041 probably null Het
Chst14 T A 2: 118,927,516 C264S probably damaging Het
Clnk T C 5: 38,713,199 T339A probably benign Het
Cnot4 T C 6: 35,068,673 K201R probably benign Het
Col19a1 A G 1: 24,279,949 V1020A probably damaging Het
Cts6 C A 13: 61,196,378 E287* probably null Het
Dbf4 T C 5: 8,398,579 probably benign Het
Diaph3 G A 14: 87,037,568 R140* probably null Het
Faah T C 4: 115,999,589 I459V probably benign Het
Fbxw2 A T 2: 34,822,833 L72H probably damaging Het
Fstl4 G A 11: 53,186,335 G640S probably benign Het
Gabrb1 C T 5: 72,108,320 T186M probably damaging Het
Gata2 T C 6: 88,202,566 probably null Het
Ifi203 A G 1: 173,933,913 V190A probably benign Het
Kdm3a T C 6: 71,611,657 E456G probably benign Het
Kl A T 5: 150,953,290 T192S probably damaging Het
Klhl3 G A 13: 58,085,062 A77V probably damaging Het
Klri2 A G 6: 129,738,895 F114L probably benign Het
Lonp2 A T 8: 86,636,587 R278* probably null Het
Lrp5 A T 19: 3,630,483 probably null Het
Med13 T A 11: 86,328,531 H363L probably damaging Het
Metap1d T G 2: 71,515,678 F194L probably benign Het
Misp A G 10: 79,827,122 K458E probably benign Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Myh2 A G 11: 67,190,331 T1258A probably benign Het
Nipbl T A 15: 8,324,580 D1691V possibly damaging Het
Nr1i2 C T 16: 38,265,938 C55Y probably damaging Het
Olfr746 T C 14: 50,653,800 S188P probably damaging Het
Olfr836 A T 9: 19,121,113 I50F possibly damaging Het
Pcdhgb4 T C 18: 37,721,292 Y247H probably damaging Het
Prmt6 T C 3: 110,249,898 I358M probably benign Het
Ric1 T A 19: 29,595,426 D755E possibly damaging Het
Sez6l G T 5: 112,475,244 T147K possibly damaging Het
Ski A G 4: 155,159,544 F451S probably benign Het
Slc45a2 C T 15: 11,022,072 T300I probably benign Het
Smarca2 T C 19: 26,696,213 V1050A probably benign Het
Spag1 T C 15: 36,211,135 S476P probably damaging Het
Sptbn2 T A 19: 4,748,138 S1964T probably benign Het
Sucla2 T A 14: 73,593,750 D434E probably benign Het
Tbl3 G A 17: 24,700,743 T779I probably benign Het
Tlr2 T A 3: 83,838,131 E215V probably benign Het
Tomm40 G A 7: 19,703,356 P227S probably benign Het
Tpp2 T A 1: 43,977,317 S711T probably benign Het
Traj32 T A 14: 54,186,108 Y2* probably null Het
Trim34b A G 7: 104,336,318 R387G probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Usp5 T C 6: 124,818,478 T651A probably benign Het
Vmn1r188 T C 13: 22,088,244 S123P probably damaging Het
Zdhhc14 T C 17: 5,493,643 L66P probably damaging Het
Zfp827 A G 8: 79,070,476 K397R probably damaging Het
Other mutations in Zfp712
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Zfp712 APN 13 67042166 missense possibly damaging 0.55
IGL02148:Zfp712 APN 13 67042158 missense probably damaging 1.00
R0085:Zfp712 UTSW 13 67041192 missense probably benign 0.00
R0332:Zfp712 UTSW 13 67040813 missense probably damaging 1.00
R1676:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R1838:Zfp712 UTSW 13 67042047 missense probably damaging 1.00
R1997:Zfp712 UTSW 13 67042050 nonsense probably null
R2147:Zfp712 UTSW 13 67041896 missense possibly damaging 0.94
R2203:Zfp712 UTSW 13 67041984 missense probably benign 0.32
R3421:Zfp712 UTSW 13 67052392 missense probably damaging 0.98
R3943:Zfp712 UTSW 13 67041332 missense probably benign 0.06
R4722:Zfp712 UTSW 13 67042113 missense probably benign 0.41
R4952:Zfp712 UTSW 13 67040841 missense possibly damaging 0.63
R4964:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4966:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4967:Zfp712 UTSW 13 67040709 nonsense probably null
R5114:Zfp712 UTSW 13 67041361 missense probably damaging 1.00
R5361:Zfp712 UTSW 13 67041015 missense possibly damaging 0.95
R5922:Zfp712 UTSW 13 67041604 missense probably benign 0.01
R5950:Zfp712 UTSW 13 67044817 missense probably damaging 0.99
R6004:Zfp712 UTSW 13 67041705 missense probably damaging 1.00
R6298:Zfp712 UTSW 13 67041329 missense probably damaging 1.00
R6499:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R6774:Zfp712 UTSW 13 67041504 missense probably benign 0.01
R6932:Zfp712 UTSW 13 67040827 nonsense probably null
R7410:Zfp712 UTSW 13 67041336 missense probably benign 0.00
R7914:Zfp712 UTSW 13 67052419 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCACTGAACTATTACTAAAGGCC -3'
(R):5'- CTGGAGAGAAACCCTACACATG -3'

Sequencing Primer
(F):5'- ACTACACTCTTTGCATGCATAGGG -3'
(R):5'- TGCAAAGAATGTGGGAAAGCCTTTG -3'
Posted On2018-02-28